Detailed Information [112805]

Strain Information
DGRC Number 112805
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}CG13298[NP2165] / TM3, Sb[1] Ser[1]
Genotype w*; P{w+mW.hs=GawB}CG13298NP2165 / TM3, Sb1 Ser1
Break points/Insertion Site 65A8
Map Viewer
Related Genes CG13298 CG7386 Trn CG8219
Original Number 2165
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP2165

NP line. Received from the National Institute of Genetics.

Balancer TM3 Sb Ser
Cluster id 1792
General Information NP_lines
Embryonic Expression pns subset (ch)
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np28465_0807
Strand Plus
Insertion Point 6152669
Chromosome Band 3L
Flanking Sequence
tttttggggnaaaaancccnanntttntncttcggtaagcttcggctatcgacgggacca
ccttatgttatttcatcatgGGCGAGAGTGTGGACGCATTTCGAGAGCCGTATCGAGTGT
GACCGTGCAGCAGCACTTAGATACATATGTGAGAGGAAGTTCGTTACATCGGAGCAGCTT
TGGACTGCAAAATTTGATTTAATATTCATTTTTTTTCATTTTGTCAATAAAATAATTTGT
TGTTCGGAAATTATATATCAGAGTGATTCAAACATTTTAAGCTGCTTAAAAATATTAAAT
TATTTATAGGCAGCCAAGTCATAAGTTCAATTGTGCATTAAGCACAATAAATTAAAAAAT
CAACTACATTAAATATAATTTTAAAACCCGTGACGACACGTTGCCATCTCTAATAAAAAA
TAGCATACTCCCTCTCTCTTGCACGGTCACACTGTATACATCTCGCTAATTGTGCAAAGA
AAAGGTGAAAAAAGAGACATTTACGCAAAATCTTAAGAAAATTCCACTAAAATAGNTTTA
AAGCACAGCCACACCCAAGGTAAGTAGGGGGTATGCGGACACGCANACTTATCTCGGAAA
GCGTTTCACCGCACCCCGATGTCCGAAATATGGCGGNGCAGGCGAGNTCTATTCGGGGGT
TTTTTTTGGCNGGGGTGGGGGCANAAATCGCACGTTACTTTNGGGCAGGGNTTTAACTCC
CNCTTTCGCCGNAAACCNTTAGNGCCAAGGAACCTCGACGGAAACGTAATTTNCACAGCA
ATGTNTGTTGNGGGGNGGGNgcaaagcccnggnngcggnggggcccaanaaagggttttn
ggccttttttttcccctttgttcccttggnggccttancctanttttattcgattcctaa
naacctaaacctgggtnnaaaaaaaaanaaaacccnccaaaacccttttggnggggccct
ttagaaggcaacntncccn

Library Name / Clone Name np / np61603_0309
Strand Minus
Insertion Point 6152714
Chromosome Band 3L
Flanking Sequence
gnnnggnggggnnngccagngggccggnnngnnnangttttttggnnnnggtctcttggg
gggnaaaaacccccagttttacgttantggangtcctcttgccgacgggnaccaccttat
gttatttcatcatgCTCTCGCCATTTAGAGTGCCCACATTCGCCACCCTGTTCAATTTTG
TTTGGGTTTGAGGCCAGACAGAGGAGTCATTAATTTTAAACAAAGGACCACGCTTCAGGA
CATTCATCCCGGGTCAGACAAAGCCGCCACACACTTTCCTCGAGGCCGAGTGAAAGTTTC
TCGCCTTGTCGCCGCTTAACATCCGAAGCGACCGGACATGAACAAGCGCAACCATGTGAG
CAGAAAACCTACGGCTCCACACACAAAGCAATTGTATTGAGTGAAAAGTGCTATTTCTTT
TGCAGATCCTCTAGCTAGAGCTTNGGNNACTAGCGGATNATGGAAACTANAACTAGAGNN
ATGATTNCNNNTAATTAATATNATGAGNNAATNNAAACCNNANGGNCATGCTNAGGGTNA
ANNANNAANATANNNNNGNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnncn

Image Files
Disc

d1 (->Large)


CLOSE