Detailed Information [112827]

Strain Information
DGRC Number 112827
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP2214 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP2214 / FM7c
Break points/Insertion Site ---
Map Viewer
Related Genes CG2893 CG40302
Original Number 2214
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP2214

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 2154
General Information NP_lines
Embryonic Expression scattered cells, AS
Larval GFP tr. strong in fusion cell.
Larval X-gal all tr, epi
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np22565_0807
Flanking Sequence
GNGGGGAAAAANANAGTTNNNGTTTTTTTGGNNNNGANTAACNGNGGGTGAAAAAACCCA
TTTTTTTGGGGGACTTCGGAAAGNCTTCGGCTATTCGACGGGNACCACCTTATGTTATTT
CATCATGATCGAAGAATACATAAGAGAGAACCGTCGCCAAAGAACCCATTATTGTTGGGG
TCCGTTTTCAGGAAGGGCAAGCCATCCGACATGTCATCCTCTNCAGACCAATCAAATCCA
TGAAGAGCATCCCTGGGCATAAAATCCAACGGAATTGTGGAGTTATCATGANGAGNTGCC
GAGTCAATCGATACAGTCAACTGTCTTTGACCTTTGTTACTACTCTCTTCCGATGATGAT
GTCGCACTTATTCTATGCTGTCTCAATGTTAGAGGCATATCAGNCTCCACTGAAGCCATC
TTATACTGGNNNNGACCNTTNGNACTACTNTNTNNCGANGANGANGNNNNACTTATNNTA
TGCTGNNTNAANGNNNGAGGCATATNANNCTNCACTGAAGCCAATNNNNNNNGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaaaaaaaaaaan

Library Name / Clone Name np / np27915_0807
Flanking Sequence
TTNNCGGTGCCACTGAAATTTAANTTGTTTACTTCCGGNAAGCCTTNGGCNTATCCGACG
GGAACCCCCTTANGTTATTTNATCATGATCCGAANAATACATATGAAGAGANCCGTCGGC
CAAAGAAACCCATTNTTGTNGGGGNCCGTTTTCAGGAAGGGNANNCCNTCCGACNTGTAA
TCCTCTNCAGACCAATCAAATCCATGAAGAGCATCCCTGGGCATAAAATCCAACGGAATT
GGGGAGTTATCATGATGAGCTGCCGAGTCAATCGATACAGTCAACTGTCTTTGACCTTTG
TTACTACTCTCTTCCGATGATGATGNCGCACTTATTCTATGCTGTCTCAATGTTAGAGGC
ATATCAGNCTCCACTGAAGCCATCTTAATCTGGNTTNGACCTTTGNTACTACTCTCTTCC
GATGATGATGTCGCACTTATTCTATGCTGNCTCAATGTTAGAGGCATATCAGNCTCCACT
GAAGCCAATNTTATTNTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnn

Library Name / Clone Name np / np59793_0309
Strand Plus
Insertion Point 193335
Chromosome Band Xh
Flanking Sequence
ttttactcgcacttattgcagncatacgttaagtggatgtctcttgccgacgggacccct
tatgttatttcatcatgGGTCAGATATAAATATACATGTACTGTATATATGTATATGTAC
GCGCGTTCGACAATGATCCNCNNNCNGNCGCNTAGGCCACTAGNGGATCTGGATCCTNTA
GCTAGAGCTNTGNGTACTCGNAAATNATNAAANNTAAAANTTTAAAAATAANCTGGCGNC
TNATTAAGATTATNAGNNAATTCAAACCCNACGGNCATGNTAAGGGTTAATCAACAATCA
TNTCGNTNNCTCACTNNNACNNNNNNNGNNNNNNNAAGNNNANNNGNNNNNNNTNNCNNN
NNNNNCNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
n

Library Name / Clone Name np / np61513_0309
Strand Plus
Insertion Point 193335
Chromosome Band Xh
Flanking Sequence
ntttttactgcgcacttattgcaagtcatacgttaagtggatgtctcttgccgacgggca
ccaccttatgttatttcatcatgGGTCAGATATAAATATACATGTACTGTATATATGTAT
ATGTACGCGCGTTCGACAATGATCCNNGGCCNGGCGCATAGGCCACTAGNGGATCTGGAT
CCTNTAGCTAGAGACTAGTGCGCACTCGCAAATGATNAAANATAANAGTTTAAAAATAAG
CNACNGCTNANNAANATTATNAGNCANTTCANACCCTACTAGCNATNGCNTTGGGNTANT
CAANAATCATNNCAGATGNNTNTNTNACANTNNCTCNNNNNNACNGANANNANTNNGATN
NNTGNNNCNNGNNNNCNNGGCAACCGTTANGNNNNNNNNNNNTNGNNTANNANNNCCANC
ACNTGANNNNATNNNNNNNNNACNGNACNANNNNACNNGNCTGNNNNNNANNNNANNNNC
NNNCCNNNNNNNNNNNANNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnt
nnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntntnnnnnnnnncn
nnnnnnnnn


CLOSE