Detailed Information [112853]
 

Strain Information
DGRC Number 112853
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}spin[NP2276] / CyO
Genotype w*; P{w+mW.hs=GawB}spinNP2276 / CyO
Break points/Insertion Site 52E7 - 52E5
Map Viewer
Related Genes CG30095 spin CG8430
Original Number 2276
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP2276

NP line. Received from the National Institute of Genetics.

Also known as SPG-2-Gal4
Balancer CyO
Cluster id 798
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression cns, yolk
Larval GFP gut, fb
Larval X-gal mt, fb, oenocyte
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2022-05-16
Research papers using this strain
[Please submit your publication]
Prasad AR, Lago-Baldaia I, Bostock MP, Housseini Z, Fernandes VM.
Differentiation signals from glia are fine-tuned to set neuronal numbers during development.
Elife (2022) 11 [PubMed ID = 36094172] [RRC reference]

Coll-Tane M, Gong NN, Belfer SJ, van Renssen LV, Kurtz-Nelson EC, Szuperak M, Eidhof I, van Reijmersdal B, Terwindt I, Durkin J, Verheij MMM, Kim CN, Hudac CM, Nowakowski TJ, Bernier RA, Pillen S, Earl RK, Eichler EE, Kleefstra T, Kayser MS, Schenck A.
The CHD8/CHD7/Kismet family links blood-brain barrier glia and serotonin to ASD-associated sleep defects.
Sci Adv (2021) 7(23) [PubMed ID = 34088660] [RRC reference]

Texada MJ, Lassen M, Pedersen LH, Koyama T, Malita A, Rewitz K.
Insulin signaling couples growth and early maturation to cholesterol intake in Drosophila.
Curr Biol (2022) 32(7) 1548-1562.e6 [PubMed ID = 35245460] [RRC reference]

Park YJ, Kim S, Shim HP, Park JH, Lee G, Kim TY, Jo MC, Kwon AY, Lee M, Lee S, Yeo J, Chung HL, Bellen HJ, Kwon SH, Jeon SH.
Phosphatidylserine synthase plays an essential role in glia and affects development, as well as the maintenance of neuronal function.
iScience (2021) 24(8) 102899 [PubMed ID = 34401677] [RRC reference]

Okamoto N, Yamanaka N.
Steroid Hormone Entry into the Brain Requires a Membrane Transporter in Drosophila.
Curr Biol (2020) 30(2) 359-366.e3 [PubMed ID = 31928869] [RRC reference]

Okamoto N, Nishimura T.
Signaling from Glia and Cholinergic Neurons Controls Nutrient-Dependent Production of an Insulin-like Peptide for Drosophila Body Growth.
Dev Cell (2015) 35(3) 295-310 [PubMed ID = 26555050] [RRC reference]

Seabrooke S, O'Donnell MJ.
Oatp58Dc contributes to blood-brain barrier function by excluding organic anions from the Drosophila brain.
Am J Physiol Cell Physiol (2013) 305(5) C558-67 [PubMed ID = 23804204] [RRC reference]

Stratoulias V, Heino TI.
MANF silencing, immunity induction or autophagy trigger an unusual cell type in metamorphosing Drosophila brain.
Cell Mol Life Sci (2015) 72(10) 1989-2004 [PubMed ID = 25511196] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np22395_0807
Strand Plus
Insertion Point 11194991
Chromosome Band 2R
Flanking Sequence
gagggaaannatgatnngttttgggnnnattaacgttgtgaaaaaccncatttttgggac
nncggaaagacctcggctatcgacgggaccaccttatgttatttcatcatgATTTGGGAC
TTACGTAAAACACTCGAATATAGCAAGCTTGTATTAACGATTTATATGGTTTGTCAATTA
ACAACTCCCGCTGAGGATGGGCTGATATGTACGAAGTACAATGTATACAATGTATATCAC
ACATCACGCGAATTCCTAATACATAATGCCAATAAAAGAGTAATACATAATACTGTATGT
TCATTTACATTTCCACCGATACCACTTTTCTAAAATGTACATTTCGAAAAGgatcgaaga
atacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaag
ggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctg
ggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaaatcgatac
agtcaactgtctttgacctttgntactactctcttgcgatgatgatgtcgcacttattct
atgctgtctcaatgttagaggcatatcagtctccactgagntntttntttnnggggnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnn

CLOSE