Strain Information | |
---|---|
DGRC Number | 112853 |
Genotype with FlyBase Link | w[*]; P{w[+mW.hs]=GawB}spin[NP2276] / CyO |
Genotype | w*; P{w+mW.hs=GawB}spinNP2276 / CyO |
Break points/Insertion Site | 52E7; -; 52E5 |
Map Viewer | ![]() |
Related Genes | CG30095 spin CG8430 |
Original Number | 2276 |
Chromosome | 2 |
Comments | FlyBase Insertion: P{GawB}NP2276 NP line. Received from the National Institute of Genetics. |
Balancer | CyO |
Cluster id | 798 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | cns, yolk |
Larval GFP | gut, fb |
Larval X-gal | mt, fb, oenocyte |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Okamoto N, Yamanaka N. Steroid Hormone Entry into the Brain Requires a Membrane Transporter in Drosophila. Curr Biol (2020) 30(2) 359-366.e3 [PubMed ID = 31928869] [RRC reference] Seabrooke S, O'Donnell MJ. Oatp58Dc contributes to blood-brain barrier function by excluding organic anions from the Drosophila brain. Am J Physiol Cell Physiol (2013) 305(5) C558-67 [PubMed ID = 23804204] [RRC reference] Okamoto N, Nishimura T. Signaling from Glia and Cholinergic Neurons Controls Nutrient-Dependent Production of an Insulin-like Peptide for Drosophila Body Growth. Dev Cell (2015) 35(3) 295-310 [PubMed ID = 26555050] [RRC reference] Stratoulias V, Heino TI. MANF silencing, immunity induction or autophagy trigger an unusual cell type in metamorphosing Drosophila brain. Cell Mol Life Sci (2015) 72(10) 1989-2004 [PubMed ID = 25511196] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np22395_0807 |
Strand | Plus |
Insertion Point | 11194991 |
Chromosome Band | 2R |
Flanking Sequence | gagggaaannatgatnngttttgggnnnattaacgttgtgaaaaaccncatttttgggac nncggaaagacctcggctatcgacgggaccaccttatgttatttcatcatgATTTGGGAC TTACGTAAAACACTCGAATATAGCAAGCTTGTATTAACGATTTATATGGTTTGTCAATTA ACAACTCCCGCTGAGGATGGGCTGATATGTACGAAGTACAATGTATACAATGTATATCAC ACATCACGCGAATTCCTAATACATAATGCCAATAAAAGAGTAATACATAATACTGTATGT TCATTTACATTTCCACCGATACCACTTTTCTAAAATGTACATTTCGAAAAGgatcgaaga atacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaag ggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctg ggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaaatcgatac agtcaactgtctttgacctttgntactactctcttgcgatgatgatgtcgcacttattct atgctgtctcaatgttagaggcatatcagtctccactgagntntttntttnnggggnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnn |