Detailed Information [112859]
 

Strain Information
DGRC Number 112859
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP2286 / TM3, Sb[1] Ser[1]
Genotype w*; P{w+mW.hs=GawB}NP2286 / TM3, Sb1 Ser1
Original Number 2286
Chromosome 3
Comments NP line. Received from the National Institute of Genetics.
Balancer TM3 Sb Ser
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression muscle subset
Larval GFP tr
Larval X-gal sg
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np22485_0807
Flanking Sequence
AAAAAAGATCATCGNNTGGAAAATTANNNCANTTTTTTGGGGACNNNCTGAAAGCCCTCG
GCTATCGACGGNAACCACCTTTTTTATTTCATCATGGCTGATCGANGAATACATAAGAGA
GAACCGCCGCCAAAGAACCCATTATTGTTTGGGGTCCGTNCCCAGGAAGGGCAAGCCATC
CGACATGNCATGCTGCTGGAGACCAATCAAATGCATGAAGAGCATGGCNTGGGCATAAAT
TTCATCGGAATTGTGGAGCTATGATGANGAGCTGCCGGGCCAATCNATACAGGCAACTGG
NTGGGACCTTGGGACTACTGTGTGGCGATGATGATGGGGGGCTGATGTNNATGCCGTNCC
CACTGNNCGAGGGATATCACNNCTGCNACTGCANCCNATCCATNCTCNCNNGNCCCCNTC
NNCGNCTNTNTNNTTNNCNNCNNTCNTCCCTTCNCNCCCNNCCNNTNCCCNNTNCCGTTC
NTCTNCCNCCCCTNCCTCTCCTNATCNNTTNCNNCCCCCTTCCCNCCCCCCGCGCNNTCC
TNNCGNTCCCTNNCNNTCCCNTGTNCCTCTCTCNTCNNTCTNNCCNCNCTNTTNTCTNCN
CGNTNCCCCCTNNNTTTNCNCGCCNTTCNTCTCGCCTCGCGTCNNNNGNNNNNNGTTCCN
GNCCNNCNCNNTTGCNGTNGTTNNATCNGGTCACNGTNCCNCGNNTCNCTCTANTCCNAN
CCTCTNTNCNCNNTTTTCCNCCNCTTNGNTGCCNTCTTTCCCCNTCNNTNCCNCNCCNCG
NAATTNACANTTNNNGNTCNnctccnantcncaatgcgcccnccgcagaantccacaaca
atnccncgtgnntcgnnncgtcntttcaccgcntnncnacnagcgtttcntggnnagntg
gccaccgacaccgcntnttcgtgnatnccacgacgatnaaagctgtcngctcccnacnan
cctccnngtcgtctttctcnncgncactaancagttngnncntgntcanagnnnncttcg
naaaccncnattnacnntacccgccatcnnccnnntnatnttccnnnnccnccacttttc
ccgcgtntcacnaccgtcagnggtgtntancacnncnncngtcgatnntcctgcncctcc
gntntccnacaatngatntaactaacaaataaaaaaaaaaaaaat

Library Name / Clone Name np / np59753_0309
Flanking Sequence
tttttggggnacttatccgcaagtatacgttaagtggatgtctcttgccgacgggacacc
ttatgttatttcatcatgGGATCCGCGGCCGGNCGCATAGGCCACTAGTGGATCTGNATC
CTNTAGCTACGAGCTNTGGNNACNNGNANATTATTAAAAATAAAACTTTAAAAATAATTT
CGTATAATTAANATTATGAGTNAAAGNNAANGCNGANANTCATATTTTTTGTGGAAATGA
TAANGNTTAATAAAGAATAANATTGNTGTTTNACTNAAACTTTANATAAANGTNAANNNA
ANATGTTTNTNNATNTNANANATANANANNTTAATATNAAGAGATTGTANNTTGATGANN
NANNAATTTAGATTTNATNNNGGNANAAANNANNNTNNGNTATNNANTNNNANNTTTTNN
ANNNNNNNNNTTAGTNNANATNNTNNNNTNNTNNANANATTNANNNANNTNNAATNTNTN
NNNAAAATTAAAAANNTTTNNTTNNTNAAAAANTANAAANATNNTATTNAAANNNANNNN
NNTNGNNTAANATTTANTATTATTNANTTAAANNNNATTNNANTTNNAATNATNTNAAAA
NNTNTATTAAAANATTTNANTTTTNAATNNANTAANTTNTTTTANNTTNTTAATAGANNG
NTNATAANATNNNANNTATNTTNTAANATAATNNTTTANNTNTTNAGAAATTNTTTNGNN
CCNGNANTNTTTTNTTGATTATTTTTTTTNNTNNNNTANNTNNNAANTATATNCCCGTTT
NTANTAATTNTNATAGATANntnnttngtgngtanaaatatttttntntttttntttntt
tnnattttnnntnntttaanntanttattaatncttatncnnaaatntttnattttttat
tttttnantttnnanaccgttccccccccccnccn

CLOSE