Detailed Information [112892]
 

Strain Information
DGRC Number 112892
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP2345 / CyO
Genotype w*; P{w+mW.hs=GawB}NP2345 / CyO
Break points/Insertion Site 26F3
Map Viewer
Related Genes CG11098 CG31635
Original Number 2345
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP2345

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 1075
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression a small # of cells
Larval GFP sg
Larval X-gal sg
Adult GFP abdomen
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np21065_0807
Strand Plus
Insertion Point 6641305
Chromosome Band 2L
Flanking Sequence
attttggngtgcactgcatttanttgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgGGCGAAACAATTTACGAGCTCTGGCCAGTGTTACCAACT
GCTCCAAGTTCTCTATATCTGAGTTATTTCGCACAACGCTATCTGGCGCGCATAGTATAT
GGCATTCGCACTGAGTCGAAAAAGATAGCAGATACTGTGAACTAGAATTCAGATAACTTA
AACAGAATGTATTTAAAACATATAAATTTCAAAGGCCATTAAATACAGCAATAAGATTTG
ATAATAAATCATATCTGTGGAATAGTTGAAACAGACCCGAAATGCCCCTTTCCTATTTCG
GTATTTTTCTGAGGCCACACAGCATTCCTTGGCGCACCCAGTACGGTCACACGAATGAAA
AGCCAACTCAGCTGAAAGTGAACCCATTTTTATACACAAAAAATTAGTAGCTGCAGCGAA
ATAAGTTGATTTCACACGACCACTGCGCCCCGAAAACAATGCAAAATGCGGGCTGACCAA
CGAGAAAGCAACAATGCAGCCCCAGCTGAGTGATTTGGCCCTGGTCCTGGGCCTGGTGAT
CGAAGAATACATAAGAGAGNACCGNCGCCAAAGAACCCATTATTGGTGGGGTTCCGTTTC
ANGGAAGGCAAGCCATTCGACATGTATTCTTTTCAGACCAATCAATTCATGAAGAGCATC
CTGGGCATAAATNCACGGATTGGGGAGTTTCATGATGAGCTGNCGAGTCAATCGATACAG
TCAACTGNCTTTGACCTTGGtactactctcttncgangatgatggcgcacttatttttgc
tgnctcaatggtagagnatatagcncgcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)

CLOSE