Detailed Information [112895]
 

Strain Information
DGRC Number 112895
Genotype with FlyBase Link w[*] P{w[+mW.hs]=GawB}NP2350 / FM7c
Genotype w* P{w+mW.hs=GawB}NP2350 / FM7c
Break points/Insertion Site 6F10
Map Viewer
Related Genes BcDNA:RE54930 roo{}78
Original Number 2350
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP2350

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 199
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression cns (TU)
Larval GFP cns + pns
Larval X-gal sg, gut
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np21105_0807
Flanking Sequence
atttttgggtgcactggnatttaantgtatacttcggtaaggctttcgggctatcgacgg
ggaccaccttatgttatttTATTCATGGGTTGGGGCGNTCTTACTGGACTTCGCTTCTTC
TTTANTACNATTTTCAGCTTGGCTGGCGGGTGCTTAATNAANGGGCTGGNATTAAGGTTC
GNCNGGGNTNTTACNAGGTGNNTCGANAATTCCTTAAGAAANNACCCGCCNCCAAAAACC
CNNTTTTNGTGGGGGNCCGTTTTANGGAGGGNNAGGCNNTNCCANNNNGTATTCNTNTTN
AANCCANCNAANTCNNGGAAANGCTTCCTGGGCCTTAAANNCNANCGGANTNGGGGAGTA
TTAATNANNNGCNGCCNAGNNANCCGNTCCAGNCCANTTGNTTTNANCCTTGGTNNCNNC
TTTNTTCCNAGGANNATGNCNAACTNNTTCNATGCTGTCTNAATGTTAGAGGCATATCAN
TCTCCACTGAGCATTTTTTTNNNGGGGGNNNNNNNNNNNTNNNGGAAAAACTTTNCCNNA
NCAAGATAGCCTGNTCNAAGANTNCATAAAANAGANCCGNCCCCAAANAACCNTTTTTTG
GNNGGGGNCCNTTTNNAGNANGGNCANNCNATCCNNCNNGNNTCCTTTTNANACCANNNA
ANNNNNNNNNNNGCNTCCNNGGNNNNAAANCNANCGNANTNGGGGNNTNNNNNNANNNGN
NNCCCNNNNANNNNANNNNNNANNNGNNTNNNCCTTNNNNCNNCNNNNTNCNNNNANNNN
GNNNNCTNNTTNTNNNNNGNnnaangnnnnggnnnnnnnnctcnctgagcnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np59313_0309
Strand Minus
Insertion Point 6878088
Chromosome Band X
Flanking Sequence
GAAGCTTCGTTAGTGGATGTCTCTTGCCGACGGGACCCCTTATGTTATTTATCATGCGCC
CAACGAATTAGGTGAAACAATCGGAGAGCGAACAAGTTGAAAACGGTAAACTTGCTCTGG
ATGAGATCCTCNNNCTGGCGCTTNGGCCACTNGNGGATNATGGATCCTNTAGCTTGAGCT
TTGCNTNCTCNNAANTNATNNTANGNGTTACTTCAAACCNNTTGGACATGCTAANGNTTA
NGNGTCAATNANANCCCNNCGNACNTGCTANGGGTTANTCAACCANCAAATCNCTGTCTC
ACTCNAACACTAAACGCAANNANACNTTNTGTNGCTNTCNNTTGCCCGCNGNGCCCGCNG
TACGGCNANNTNNTGGTNNTNNCNNCTNTTTAACCNCCNNCNGTNGNTNNNGCNNTCNTN
CCCCNTANCGNNTNGACTTGCTCTCGGTGAGTTCNNNNTNCCTCTNCNCTNNTTANCTCN
CTNNCGNTNGNTGATTCCCNCNCTCCTNGTNNNCTCNTNNCCCCNCTTTCNNTNCNGCNN
NANNNTCNCCCNNTTTTNACCACTTNTNTNCCNTNCTTCCNCCCGNGTTTNTTGNTGCAA
TTGTNTNNCCCCCCNTTNNGCCNTCCCAACGTTTCNGANTTCGTCCTNNTGNCNCCACCT
CNCNCCTTTCNTTCTNTTTTCNNCNNNTAANTNACTNCCNCTCNNNTTNNTTTGTGNGCA
NGNNTTCNNCNTCCCTNCNTTTCCCNTNCTTTACNCGCCANCNNNTTTNCCNNTTNCCNC
NCNGTCNNTGNTNCNNGNCGactntttcttcatttctctccnttncgnccccctantcnc
cttcncncntcccccttccctntctacacgctgncnnctcngnccgacannagtnnttnt
cgccgntgcanagactanattnttcgcnttngtttttattaannctccnaccntgtttng
ntaccntccgnnnntgntnngtcttcctcctctttcnccncacttttttntacgntcntn
ttttttccccatttncacccccctnttttntcccctcccctctt

CLOSE