Detailed Information [112920]

Strain Information
DGRC Number 112920
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP2424 / CyO
Genotype w*; P{w+mW.hs=GawB}NP2424 / CyO
Break points/Insertion Site 46E1
Map Viewer
Related Genes eiger CG1371
Original Number 2424
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP2424

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 646
General Information NP_lines
Embryonic Expression dorsal epi, AS, cns
Larval GFP fb
Larval X-gal fb
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np21635_0807
Strand Minus
Insertion Point 5139074
Chromosome Band 2R
Flanking Sequence
ACNNNCTGTNNGGGAAAAAACCCCCCNTTTTTTGGGGGCNNNNNAAAAAACCCCCGGCCT
ATTCGACGGGAACCACCTTTTTTTGGNTTCATCATGGCGTGAACTGNCCGGAAAACGAAC
CGAGCGGCACTTGATTTCTCACGTTCGAGCAGGCAGGCGAGCAAGAGGGACAACGGATTG
GCACCGTCTCCCTCGCTCACGTGGCGAGGATGCTCGGCATACTTAAGGGCGCCTGNTTTN
TTTACTNGGGGTAATTAATTTTGGGCAAGGTTCTCCCGGGGTGGTGTTTTGGTGATACAG
TGGGCTCTGGCTAACAGGAATTAAATTAATTATTATATTTCTACAATTTTACATGTACAT
ATGCATATGTAGATACGATNTTGATTTATTATAACAAATTATTNGTATGAAACTCATAAT
CATGGGGGGCATAAGAAATATTGACAAAAATATGATTCATAATNTGATATAACACTAAAT
AATAGGNGATATAGGNTAAAGGGGGNAACAATGGAACAATGGGNTNATAATGGNAATNTN
AAANGGNAATGCTNAAATNACGAACTTGNATAACATGGATNAAAAGAGAAGAAAATNGGG
GGNNGTAATNGGAGNANANTGGATGCCATATTGGAAGACCATNTGATGGGGGGGGGGGAG
CCAAGACAGACTGANCTTGGGNACNNANNNCCTTGNACATATGGGGATGGGAGAAATCCA
NAAGAGAGAANCCGGGGNGNAAAGAACCCCATTGATTGAGTGGGGAAGNGAGGNNAAGGA
ANGGGCAAGCCCAAGCCAACatgaggnnggccccnggagaccaancgaaaangcangnaa
aanccngccngggngcnnnaaaacccaacggngaatnggagnggccggcgaangaggngc
ctagnaggagagaaccggngccaaggnncaggagngggngnccaggaggcnnccgnggag
ggngggngataggagccggaagagannggtngcggangtnggngcgctagagggngnnct
ganccggngcatnaanacggccgncggncanaannaaaaaaaaaaan

Image Files
Disc

d1 (->Large)


CLOSE