Detailed Information [112948]
 

Strain Information
DGRC Number 112948
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Gug[NP2517] / TM3, Sb[1] Ser[1]
Genotype w*; P{w+mW.hs=GawB}GugNP2517 / TM3, Sb1 Ser1
Break points/Insertion Site 66C13; -; 66D1
Map Viewer
Related Genes CG6915 Gug CG6983
Original Number 2517
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP2517

NP line. Received from the National Institute of Genetics.

Balancer TM3 Sb Ser
Cluster id 1828
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression muscle subset
Larval GFP tr node. dorsal longitudinal muscle.
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np23725_0807
Strand Plus
Insertion Point 8414158
Chromosome Band 3L
Flanking Sequence
annttnnggtgcantgccttttttttgtacttcggtaagcttcggctatcgacgggacca
ccttatnttatttcatcatgGGCCAATGGATATTTGCACCTGGGGTGGACCTTGGTCTCG
TGGTTTATGGGTGTCATTAAACGCGAAATAATTAGATTAAGGGCTTATTAAATTTATGCT
AAATGGTTTCGCTTGGGTTGTTAACAAGTTTTTATAACTGTTTTTTTTTAGCAATTGTAT
AAAAGTATATACAATAATAATTATGTGTGGGTATTTTCAACATATAAATGAACAGAAGAA
AAAATTGGGTATAAATCAGATTTCAATTTGTGTTTTTATTTGAAAAGCATAAAAGTAGAT
TATAAAAGCGTTATATTCGGATTAGAACCCATAGAAGGTCCACCCTAGAGAGCACAGGTT
AGTCGGAGGAGGCGAGTACAGTGGCAGCGTTGTGGGTCGTTTATTTGGCTTTTGGAGCGT
TGACTCGTCGTTGTCGGCTGTGCATGATGATGATGACGATGATGATGCAGAAGAGAATGA
TGATGATGATGACGACGACGACAACGATGGAGAGGAGACGAGGCTGCTTGAATAGATGCT
CAATCGTTTGGGTTGAATGAAGAAAAGCATGTGGAGTGGCGAGTGGAATGAAGTGAAGTG
CCCCATGGAGTCCGTGTCCATGTCCGTATCCGNGTGTGTGGCAGAGATTGGAGCATGAAT
AGGAATGCCCAGAAGGAGACCATGGAGGAGGAGGAGGAGGAGCATTACNCCAGCGNGAGN
GCCCCTGCGGGGGCATAATGttcttggtngatggtggagtaaaggggcataacaactgna
agctggctngccngacnaaaaccagaagccgggnngaacctgcnactngaaaaagctngn
anccgagggngcnnaaaaggtccananaaccaacaattccttaccccggcgnaaaaaaaa
aaaattttttaagggtttttgggcnnacncgn

Image Files
Disc

d1 (->Large)

CLOSE