Detailed Information [113008]

Strain Information
DGRC Number 113008
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP2687 / TM3, Sb[1] Ser[1]
Genotype w*; P{w+mW.hs=GawB}NP2687 / TM3, Sb1 Ser1
Break points/Insertion Site 87B13; ---
Map Viewer
Related Genes CG40153 CG40365 CR32865 DM88{}1307 invader1{}1308 invader1{}1309
Original Number 2687
Chromosome 3
Comments NP line. Received from the National Institute of Genetics.
Balancer TM3 Sb Ser
Cluster id 1460 2102
General Information NP_lines
Embryonic Expression scattered cells, sg
Larval GFP cns
Larval X-gal sg, ch
Adult GFP body (MT)
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np24175_0807
Strand Plus
Insertion Point 8301303
Chromosome Band 3R
Flanking Sequence
gggnnagggntgttngttttttggnnngacaaaacgggtntaaaanncccgtnnnnnngg
gcgnncggaaaagacncccggctattgacgggaccaccttntgttatttcatcatgTTCT
TGACTTTACATGCAATACCAACACAATTATGACAGTTGTTCTAGTCCGCATACACCAATA
CTTATGCACACCGCATTTTTCTGTATGCTTCTCGCTTTCGTACAGACATCTACTTCCCCC
CGCTCTCCACTAAACTCTAACGGTTGTCTGCCGCGCATCAGAGNNNNAAAAAGAGGCGTC
TGCATGGCGCGTGCCAAGCAGCAACACGAAATTTCGTTTCATTTAAATgatcgaagaata
cataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggc
aagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggc
ataaaatccaacggaattgtggagttatcatgatgagctgccgaggtcaatcgatacagn
caactgnctttgacctttgntactactctcttccgatgatgatgtcgcacttattctatg
ctgnctcaatgntagaggcatatcagtctccactgagccatnnnnnnntngggnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaaaaaaaaaaan

Library Name / Clone Name np / np60393_0309
Strand Plus
Insertion Point 3251572
Chromosome Band U
Flanking Sequence
ntttgnctncgcacttattgcaagtcatacgttaagtggatgtctcttgccgacgggcac
caccttatgttatttcatcatgGTCAAGAACTACGCATAATTCTGATTTTGTGAAGAAGA
GATCCTCTAGCTAGAGCTTTGNNNACTCGCNAATTATTAAAAATAAAACTTTAAAAATAA
TTTCGCCTAATTAATATTATGAGTNAATTCAAACCCCCGGGCATGCTCANGGGTAANNGA
CACNCATATCNCNGTGTCTCTCTCACACNNNANACNACNCTCANANNTCTATCNCTTACN
CTCGCTCTTNGNGNGNGCACNCGTAGNGGGTGTGTCTNGCGCACGGGGCCCCCNNATGTG
NTNTNATCATGNGNAAAAACAACGCACAANTTTGNTTTTGTGAAAAAGAGATACTCTTGC
GCGAGCTTTNGGNACTCTGGAAAATTGATANTCTTACTCTAGANNTGNGNTCNCGCGNTN
ATATNATACNGAGATANTNAACNCCCCGNGNNCANNCTNAGGNTTNAGCAACAATCATAN
CGNTGCNNNCTNANACNGNNNCNCCNCTNANANTTNTNTNCCTTTCTTNNCNCTNNGNGN
NTNNNNNNGNNNGNGNNTNNNTCTNGNNCTNNGNCACCCTCTNNNTNTNNNNNNNNNNTN
NNANNNCCCACNNTNTNTTTNNGNNNANAANNTNNTNNNNNCNNNNNNTNNNNCNNTNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCCNCNNNNNNNTNNNNNNNNNNNNNCNNNNNNN
NNTNNNNNCNNNNNNNNNNNnccncnnncnnnnnnnnnnnnccnccnnnnnnnnccnnnc
ccnnnnnncnnncnnnnnnnanncnnnnnnnnnnncnnnnnnnnnnnnnnnnnnc


CLOSE