Detailed Information [113011]

Strain Information
DGRC Number 113011
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP2697 / CyO
Genotype w*; P{w+mW.hs=GawB}NP2697 / CyO
Break points/Insertion Site 30C9
Map Viewer
Related Genes CG18854 CG4026 CG4110
Original Number 2697
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP2697

NP line. Received from the National Institute of Genetics.

Original Comments comment1:2L 30Cb
Balancer CyO
Cluster id 1137
General Information NP_lines
Embryonic Expression weak
Larval GFP fb
Larval X-gal fb
Adult GFP body (MT)
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np24255_0807
Strand Plus
Insertion Point 9774505
Chromosome Band 2L
Flanking Sequence
atcttttngtgcactgactttaantgtatacttcggtaagcttcggctatcgacgggcac
caccttatgttatttcatcatgTCTCTGGCACTCCAATTCCCAGAGAACACTTCGTGAAA
CTGCCGAGAGCCGAACGAGCGGCGACGATTGCCGAGCTGTTTgatcgaagaatacataag
agagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagcca
tccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaa
tccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgt
ctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatgctgtctc
aatgttagaggcatatcagtctccactgaagcatntttnttttnggnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnaatttnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnann

Image Files
Disc

d1 (->Large)


CLOSE