Detailed Information [113041]
 

Strain Information
DGRC Number 113041
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP2765 / TM3, Sb[1] Ser[1]
Genotype w*; P{w+mW.hs=GawB}NP2765 / TM3, Sb1 Ser1
Break points/Insertion Site 65E4; -; 65E5
Map Viewer
Related Genes CG14824 CG8634
Original Number 2765
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP2765

NP line. Received from the National Institute of Genetics.

Balancer TM3 Sb Ser
Cluster id 1799
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression a small# of cells, gut
Larval GFP muscle attatchment site
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np15615_0727
Flanking Sequence
ncttnggngcactgaacnttanttgtatacttcggtaagcttcggctatcgacgggacca
ccttatgttatttcatcatgAGCGCGCGCAATCGGGCGATCGAAGAATACATAAGAGAAG
NANACCNCCGGGTTTNNCCGGGNCNCCCAATAANAGGNNAAAACCCCCCCCAATTTTTAT
NTNNGGTTTNNGGGGNGGGGGTTTTNCCCCCCGGTTTTTTTTTTTTNCCCAGGGGGAAAA
AGNGGGGGGGNCCCNAAAGGGNCCCCCANTTTCCCCCGNNACAATTGGNTTCCAATTNNC
TCCTTTCNTTTTNCNAGNACNCCAAATTCNNAAAANTGCCCCAATGGGNAANAGTNAGGT
CNCTATTCCCCCCCTTTGGGGGGGGCCCCATATTTAANAAAAAAAANTCCCCCCNAACAC
CCGGGGANAAGANNNNGGNGGGNGGGNNGGGGAGNTTTTATATCCNATNGGGANGAGGAN
GAGCCCTCNCGGCCCCCCGAGANNTTCNAAAATTTNNCCGGNNTNTNCCCCCCNAAGGNC
CCANAAAACNCNGGGGGGGGCTTTTTTTGGGANCCCCCTTNTNTNNGGGNGAAAANNTNN
NAACCNCTCNTCNTNTTTTNCCCNCCCCNNNANNANANNAANNNNNANNANNNNNNNCCN
CCNCCCCCNNCCCTTNATTTNTTNNCTTTTTTTTNGGGGGNGNGNNGGNNNNCCNCCNAA
AANTAGAANANTNNNNGNAAGANGANGGGGNGGGNNATTTTTTTTNNTNTTNNATGNANG
NTTTTTTCTTNNCCCCCCNCccccnggnaggggagaaggananncccnccnnnctttant
tttttttnttnattnnngnggnnggggnggngnnnnnntnnntnnnntnnttnnttnntn
tnntntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnnnnnn
nnnnnaat

Library Name / Clone Name np / np57583_0309
Strand Minus
Insertion Point 7054302
Chromosome Band 3L
Flanking Sequence
actttttnctgcgcacttattgcaagtcatacgttaagatggatgtctcttgccgacggg
caccaccttatgttatttcatcatgCGCGCGCTCAAAGCGCTCTGGTAACCGGTTCGCGA
ACCAGTTCCGAATAACAGAGAGGCACACAGTGAGCATAGTTGTAATTTTAAATAAGCGTT
AGGATTTGTCGAGTTTAAAAAAGTAATTTATTAAACAAAATGTATGTTTCAATGTAATGA
ATATTTTGGAAATAGAGCAGCTTAAAGTTAGTTACTTATTATTAATACTTATACTGTACG
TAAACGATCCTCTAGCTAGGGCCTTTGGGNACTAGNGGATNATGGATCCTATANCTTAGN
CTTTGATTTCGNNTAATTAATATTATGAGNAATTNAAACCCCACGGACATGCTAAGGGTT
AATNAACANTNNTNTNNNTGNNNNNNTNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE