Detailed Information [113089]

Strain Information
DGRC Number 113089
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}CG9894[NP3074]
Genotype y* w*; P{w+mW.hs=GawB}CG9894NP3074
Break points/Insertion Site 23A3
Map Viewer
Related Genes Pgk CG32951 CG9894
Original Number 3074
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP3074

NP line. Received from the National Institute of Genetics.

Cluster id 1009
General Information NP_lines
Embryonic Expression caudal (ap?)
Larval GFP epi
Larval X-gal sg
Adult GFP internal
Reference

() [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np34685_0907
Strand Minus
Insertion Point 2746998
Chromosome Band 2L
Flanking Sequence
attttttgggtgcactgnctttntttgtatacttcggtaagcttcggctatcgacgggac
caccttatgttatttcatcatgAGTCTGAGAAAAGCGCTTGATTTGCCAATTTATCTGCC
TTACTGGCCGAACTATTTTATTTTTATCAAGAAATGTGCTACTCGATTATGGAATGCGAC
TGCTTCAGGCCCCCAAAACTTGTTCGAATACCGCGTGCTCTTGGCGATACTAACCAAAAA
TAAAGTGGCCAAACATGACATGAGTAATTTACCGGCCGGCAATGTGTGTTTTCATTGAGA
GAGTGCATTGGCATCGCGCTGAATTGCGTTTGCGTTTGCATTTGCAATTCCCGTAGCCAC
AGCGACTGATAAATAAGGCCAAGCGTATGAGTTATAGACGTAATGCCACAATGTATCTAT
TGCTGGGTAACGCTGTTCAGCGGACACGTCAATGCTAATGACCTATGGGTTTATTAAAAA
CACATTACCCACCCCACCAAAGAAAAGGCCCTGGCTAACTGTACTCCCCGCCTATATAAG
CACGGCGGCCCTCCTAACCTCGATTTGAACCTAACAACAATAATCTTTGATTGCCGGACC
CGCAATCATCTTGGTTAATCGTAAACAACACAAACGCACAACCGAGCCAGCTATACGCTC
TCTCTTTTGGGGGCATATGTAAGCCATTGGGGAGAGTGCGCTGTTCCGAAAAACGTGTGT
ATATCTATTTCTAGAATTTTTTCCTCGAACAATGCTATGCTACTGGCATATTGGCTTGGA
GTGAATCATTAGANGGGCCTtccttttttggtttacccgggtnaacaactacctagtcac
atagattcgnagaatncntaagaaagaacccgnngncnaagaaacccattt


CLOSE