Detailed Information [113089]

Strain Information
DGRC Number 113089
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}CG9894[NP3074]
Genotype y* w*; P{w+mW.hs=GawB}CG9894NP3074
Break points/Insertion Site 23A3
Map Viewer
Related Genes Pgk CG32951 CG9894
Original Number 3074
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP3074

NP line. Received from the National Institute of Genetics.

Cluster id 1009
General Information NP_lines
Embryonic Expression caudal (ap?)
Larval GFP epi
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np34685_0907
Strand Minus
Insertion Point 2746998
Chromosome Band 2L
Flanking Sequence
attttttgggtgcactgnctttntttgtatacttcggtaagcttcggctatcgacgggac
caccttatgttatttcatcatgAGTCTGAGAAAAGCGCTTGATTTGCCAATTTATCTGCC
TTACTGGCCGAACTATTTTATTTTTATCAAGAAATGTGCTACTCGATTATGGAATGCGAC
TGCTTCAGGCCCCCAAAACTTGTTCGAATACCGCGTGCTCTTGGCGATACTAACCAAAAA
TAAAGTGGCCAAACATGACATGAGTAATTTACCGGCCGGCAATGTGTGTTTTCATTGAGA
GAGTGCATTGGCATCGCGCTGAATTGCGTTTGCGTTTGCATTTGCAATTCCCGTAGCCAC
AGCGACTGATAAATAAGGCCAAGCGTATGAGTTATAGACGTAATGCCACAATGTATCTAT
TGCTGGGTAACGCTGTTCAGCGGACACGTCAATGCTAATGACCTATGGGTTTATTAAAAA
CACATTACCCACCCCACCAAAGAAAAGGCCCTGGCTAACTGTACTCCCCGCCTATATAAG
CACGGCGGCCCTCCTAACCTCGATTTGAACCTAACAACAATAATCTTTGATTGCCGGACC
CGCAATCATCTTGGTTAATCGTAAACAACACAAACGCACAACCGAGCCAGCTATACGCTC
TCTCTTTTGGGGGCATATGTAAGCCATTGGGGAGAGTGCGCTGTTCCGAAAAACGTGTGT
ATATCTATTTCTAGAATTTTTTCCTCGAACAATGCTATGCTACTGGCATATTGGCTTGGA
GTGAATCATTAGANGGGCCTtccttttttggtttacccgggtnaacaactacctagtcac
atagattcgnagaatncntaagaaagaacccgnngncnaagaaacccattt


CLOSE