Detailed Information [113099]

Strain Information
DGRC Number 113099
Genotype with FlyBase Link y[*] P{w[+mW.hs]=GawB}NP3096 w[*] / FM7c
Genotype y* P{w+mW.hs=GawB}NP3096 w* / FM7c
Break points/Insertion Site 2D2
Map Viewer
Related Genes ph-d FB{}23
Original Number 3096
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP3096

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 57
General Information NP_lines
Embryonic Expression muscle
Larval GFP cns
Larval X-gal sg, DT
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np34875_0907
Strand Minus
Insertion Point 1880053
Chromosome Band X
Flanking Sequence
gnnggngngnnnnnnnaggggcccggnggtgntangtttttttgnnnggnaanacttggg
gggncaaanacccntttttggggacttncggaaagacntcggctatcgacgggaccacct
tatgttatttcatcatgGCTCTGCTCTCTTTGCGTTCGTGTTGGTGTGGTGTCGATGTGT
CGCATACCGCATGTGTATTGAACGGGGGAAAAAAAAAGCGCCGACGCGACGCACACACAC
CCTACCACCGTTTCGTAGNATTNATTNATATATTNATTTTNGGCGATCGAAGAATACATN
GGNGAGAACCGTCGCCAAAGAACCCATNATTGTTGGGGTCCGTTTTCAGGAAGGGCAAGC
CATCCNACATGTCATCCTCTTCAGACCAATCAAATCCATGAAGAGCATCCCTGGGCATAA
AATCCAACGGAATTGNGGAGTNATCATGATGAGCTGCCGAGTCAATCGATACAGNCAACT
GTCTTTGACCTTNGTTACTACTCTCTTCCGATGATGATGTCGCACTTATTCTATGCTGNC
TNAATGTTAGAGGCATATNAGCCTCCACTGAAGCCATCCNNTTCNGGNNNNNNNNNNNNC
CNANANGANGNNNNANNNNNNNNNNGCNGNNNNANNGNNNNAGGCNNNNNNNNNNNNANN
GAAGCCAGNNNNNNNNNAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnncnnnnnnnannnncnnannan


CLOSE