Detailed Information [113101]
 

Strain Information
DGRC Number 113101
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP3099
w*; P{w+mW.hs=GawB}NP3099
Break points/Insertion Site 3C1
Map Viewer
Related Genes EG:BACR43E12.1 w
Original Number 3099
Chromosome 3
Comments NP line. Received from the National Institute of Genetics.
Cluster id 91
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression a small # of cells, sg (TU)
Larval GFP epi
Larval X-gal sg, tr
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np34895_0907
Flanking Sequence
GATTNTTAAAAGGANNANCGGTTGGAAATTGNGATCCTNNTGGGGGGGNNAAAAAAAACC
CCGGCNATCGACGGGACCACGNTGNGGGAGCNAAGNTGGGANAANANANCCGACGGGGGC
GGCGCGGGGGCAGGGGCNGNGGNGGACAAGGNGGCNGAGANGCAGANNGCNCCCGGNCGN
GAAATNGANGAAGAGGNNGNGGGGGCGGANAANAAAAAGNAATANAAAAATTTTTTTTTT
NGGGGGGNCGNGNCAANANNTGGGGGGGGGGGNGAAGAGANCNNNGGNNCGAGGGCNCCG
NCGNNGNNGGGGGGGGGGGGGGGGCNACGCNGACNGANNGAAAGAGGCNNANGAGGNCGC
CNNGGAAGGNGGCNCACCNNGNGGNGGGGNNNANGCGGGGNNNNGNNCNGGNGGNGGGNG
GGGGNNNGGNCGGGGGCGNNGGAGNCNGGNGGNGCCNGNNGNNCGNNGGGGCNCGGNNNG
GCGNNGGNCNNGGGGNNGNGNGNGGGGCGNNCGNNNGNGGNGNGCGGGNGGGNNNNGCNG
CGNGGCCCNNCGGGGCGGNGGGGGGCGGGNGGNGGGNNCCNAGGNCGGGGNGGGGGGGNG
GCGGGCGGGGGNGNGNNGNGGCGGGCGGGGGGGNNNNCNCGGGGNGNGGGGGGNGNNNGG
NNGGGGGGGNGGGGGCGGCGGCGNGCNGGGGNGGGGGGGGANGNGGGGGGCGGGNNGGGN
NCCCCGGNNNCGGNNAACANANACAGCCGGGNNCNCCCNCGGGGGGNNCNCCGNANCGGG
GGGGGGGGGCGCGGNGGGGGgggggggcgnngnngnaggcanacnggggnganncgnggc
cagnnnggaancgcggggggggcgggggggccnngnaanggcnnggnngaggcgggaggg
gggccggcgnngaaaaanngngggggngggcggcggcggnngggcggganaanncngagn
ncggcgnngangcgtnggnggggggnggagggngaggnngggggcggggggggacnnnng
cgggggnaangncggcgccggagancnggggggagnngnaaaaaaaaaaaaacnaaaaaa
an

Library Name / Clone Name np / np63373_0309
Strand Minus
Insertion Point 2553634
Chromosome Band X
Flanking Sequence
ttttactcgcacttattgcaagcatacgttaagtggatgtctcttgccgacgggaccacc
ttatgttatttcatcatgNGCGGAGCAAACTACTTTTACTCANTCACTGGGACACNANCC
GCGGTCTTGTCGCNTGGTNCNCTAGTGNTATNTCTAATATCTGTATCTGAANAGAGNGCG
CNGAGCANTAAANACTATNTNGGACGNCCGANCAGCNTATACAAGCNAAGGNGCACGGNG
AACANANCANCGATTNGNAACGCTGTACNCACANCCAANCACATCTGAGGATGACCTCCT
ACTTNCGATCAAGNGCNNGGTAAAGNGAATNAATTTAAATTTNCCAACAACCAACCAGTT
AAACTAANAACTGNNNCTACTGAAATCAACCAANATNTNATTATTGANNACAAGAAGAGA
ACTCTGAATANGTNGATAGCGTGAATGTCCNNCTTCAGTTGCACTTTGNCAGCGGTTNCG
TGACNAANCTCCAAGCGGTTTACGCCATCAATTANAACACAAAAGTGCTGNGCCAAAACT
CCTCTCGCTTNTTATTTTTGNTNGNNGTNTGAGAGANNGNGGNGGNGATNGGTTTTGGGN
GGGNAAGCNNCCNNAANNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNANNNNNNN
NNNNNNNNNNNNNNNNNNCNCCNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNANNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnannnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnncnnnnnnnnnnnnnnnnnat

CLOSE