Detailed Information [113110]

Strain Information
DGRC Number 113110
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}CG11367[NP3112]
Genotype w*; P{w+mW.hs=GawB}CG11367NP3112
Break points/Insertion Site 80A1
Map Viewer
Related Genes CG11367 CG14450 CG32454
Original Number 3112
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP3112

NP line. Received from the National Institute of Genetics.

Cluster id 2036
General Information NP_lines
Embryonic Expression muscle
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np35035_0907
Strand Minus
Insertion Point 22645384
Chromosome Band 3L
Flanking Sequence
cgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccaccttat
gttatttcatcatgCCGCAGCGAGAGTGAAAGAGAATGTGAGAGGACAGAGAGCGTGCAG
TGCTGCGATTTTAGCATTTTTCTTTAGCCATACTATACGGACTGCTCCAGTTTCTTCTTC
TTTAAAAATTAATTAATAATGTGATTTATATTATATTTATAAATTATTTCCTTTGTAGTT
TTACCTAAAATGTATAATGATTGCTGTGTGAAATACATGCCTTTTCTCTCATCTTTTTCA
CTTAACAATTAGTTGCTATAAATTGTTTGTAGCCGTCGATGGTGTAGCATTGTATATCGA
TTAATTAGAAAAACTGAAAAAATGAGCTTGGTCCCACTAACCGAACAGCTGTATAGACGA
TATCAAATTAAGTAACAACAAATATAAATCATATACTGGAAAATATGTTGTGCCGGCGAT
CGNNGAATNCNTAAGAGAGAACCGGCGCCAAAGAACCCATTATTGGTGGGGGCCGNTTTC
AGGAAGGGCAAGCCATTCCNACATGTCATCCTCTTCAGACCAATCAAATCCATGAAGAGC
ATNCCTGGGCATAAAAACCAACGGAATNGGGGAGNTATCATGATGAGCTGNCGAGTCAAT
CGATACAGTCAACTGGCTTTGACCTTTTGGTACTACTCTCTTCCGATGATGATGTCGCAC
TTATTCTATGCTGGCTCAANGNTAGAGGCATATCAGNCTCCNGCGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnngggnnnnnnnnnnnnnncnggaannnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nn


CLOSE