Detailed Information [113124]

Strain Information
DGRC Number 113124
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP3145
Genotype w*; P{w+mW.hs=GawB}NP3145
Break points/Insertion Site ---
Map Viewer
Related Genes CG40191 CG40192
Original Number 3145
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP3145

y[*] seems to be fixed. 13Jul2011 M.W.

NP line. Received from the National Institute of Genetics.

Cluster id 2085
General Information NP_lines
Embryonic Expression fg
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np35275_0907
Strand Plus
Insertion Point 2141726
Chromosome Band U
Flanking Sequence
ttttttgngtgcactgantttaantgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgTTCTGACTGTTTGCCTTCTCTATTCTTCGTTACGAGTAG
CGAGTATgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgcatgg
ggtccgtttncaggaagggcaagccatccnacatgtcatcctcttcagaccaatcaaatc
catgaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctg
ccgagtcaatcgatacagtcaactgtctttgacctttgttactactctcttccgatgatg
atgtcgcacttattctatgctgtctcaatgttagaggcatatcagnctccactgaagcca
tntttttttttgggncnttngntnnctnctctnttnncgangatgatgtcncacttattt
ctatgctgnntnaatgttagaggcatatcagnctccactgaagccatnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
tnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np63413_0309
Strand Minus
Insertion Point 2141733
Chromosome Band U
Flanking Sequence
ctttnctcgcacttattgcaagtcatacgttaagtggatgtctcttgccgacgggaccac
cttatgttatttcatcatgAGTCAGAAGAAGCCAAATGCCTTAAAAGAGATGAGTAACAA
AAACACTTATGGCTTTACCGTTAAACACATGGGTGTTTGCAAAAATACTCGGGTGGTATC
GTAGATACTCGAGTCAAAGACAAGATCCTCTANCTAGAGCTTTGNNTACTCGCAAATTAT
TAAAAATAAAACTTTAGAAAATAATTTCGTCTAATTAATATTATGAGTTAATTCAAACCC
CACGGCNCATGCTTAGGGTTANNCNACAATCCTATCNCTGCNGTNCTGCTATNGGANTNN
ACACTNNCTNACAATNNTNTNNCTTNNCTNNNNNNNANGGANACNNTNNGTNNNTTGNNT
NTNGNNTNNNNNNCCNNCNNNNNTTATNTNATNNNNNNNNNNNNNANNNNAANNGCCTTN
NNNNANANGNGNNNCNNNANCNNTNNNNGNTTNNCCGNNNANCACANGGNNGNNNGNAAA
AANCTNNNNTGGNNTNNNNNATCTNNNGTNNAANACAANANNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNANNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnn


CLOSE