Detailed Information [113180]

Strain Information
DGRC Number 113180
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Alh[NP3247]
Genotype w*; P{w+mW.hs=GawB}AlhNP3247
Break points/Insertion Site 84C1
Map Viewer
Related Genes Mlp84B Alhambra CG14612
Original Number 3247
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP3247

NP line. Received from the National Institute of Genetics.

Cluster id 1365
General Information NP_lines
Embryonic Expression all muscle
Larval GFP gut, sg
Larval X-gal mt, epi
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np36085_0907
Strand Minus
Insertion Point 2929259
Chromosome Band 3R
Flanking Sequence
gcactgaattaagtgtatacttcggtaagcttcggctatcgacgggaccaccttatgtta
tttcatcatgGGGTGGGCGAAATCAAAATGAGCGGAGTTGTAGTTACTCTCTCGGTAGGC
CATGCTCTTTATTGTTTTTTTTTGTACATTCGGNGCATGTAACATTTGTTGCCCCACACA
AACCGACGTATAAATATACATATAGTATATAATTCAGCTGCATATGGCAGCATATGTCGA
GGCAAAACCACAAAAGTAAAAACGGNACNACAGCAAGAACAACGTGAAAAACTCGCCCAG
CATTGCAGCAACATTTGTTGCAGCTGCAGCCCTGGATGTCTTGCATTCTTTTTAAAACNT
CTGACTCACNTACTTGGTCCGNTCGGTTTTTTTTTTAAAAANAANTTTCCCCCTTTTTTT
TGGGGGGGGCNCCCAACNTCAANGANAAAAGCCTTGGGGNGTTGCATTACCGGGGGGCNN
GTNTTTTTTTTTTTNTGGGAACCNATTTTTTTTNGGGGNTNGGGNAAANNCNCCCTTTTT
TTTTTTTGNANTNCNCCCCCCGNTGCATTTTTTTGGGAAAAAANAANAAGGGGCTTTGNN
NGGGANTTGNGGGGTCCACCCNCAAAAANTTTTAAAACCCCCCNTTTTNGGGCCCCCNTA
AAAAAANGGGGGGCCTTTTGGGGGGNTNTCCNAANCCCAAGGGGTNTTNGGGGGANNGTT
TTTTNTGNGGGGGGGGGGAAAAANANGNNTTTNNAANGGGCCNCCCNCNNCCCGGGNNNT
TTTTTTNNCCCCCAAATTTAaaaaaanattncccccggagannnanncccttttttcncc
ccgnggnggtcnccccttgggnaaatttnaaaaantttnnnaaaantttttaaaanctcn
ggggggnttnttaaaagggnaaaaaanntcgggtttttngggaaaaatttnccanggggn
ggncctttttna


CLOSE