Detailed Information [113272]
 

Strain Information
DGRC Number 113272
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Vha16[NP3427]
w*; P{w+mW.hs=GawB}Vha16NP3427
Original Number 3427
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP3427

NP line. Received from the National Institute of Genetics.

General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression broad mesodermal
Larval GFP all gut, fb
Larval X-gal gut, mt, tr
Adult GFP mouth, antenna.
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np11135_0727
Flanking Sequence
antcntttggggtgnantgccatttttttgnatacttcggnaagccttcggctatcgacg
ggaccaccttttgttatttcatcatgCTCCACACAAGCGCAATAATCCGACGAGTGGCCT
CTCGCTCAATCTCACTCTCTCTTGCTGCTCTCTCCCAGTTTTCGTTGTTGGCCACTCGCT
CCGACTTGCCAACTCTCGATTAAAAAGTATATTTAAGAATATTNTTNTGAGCGGCCACTC
GCAATTNGTTCGTCGTCGCAGCAGCATTGGTCGCAGAGCAGCGTAAAACCCCACGTATAT
AGCACATATATTGTACATATAATAAAAATACTTTGTTTCGACTTGAAGCAACGCATACAT
ATAACGAGCGCGCATAACATTCAGATTCATCTGTGCAAAACGCCGAATAAAAACTATAGT
GCAATCACCACAGCAGCAGCAAAACGAACTAAAATTTCGATTTCTCATCATTTGTAGCCT
AAAAAACACACAACAAACAAAGCAAAATGTCTTCTGAAGTGAGCAGCGACAACCCCATCT
ATGGCCCCTTCTTCGGAGTTATGGGAGCCGCCTCCGCCATCATCTTCTCGGGTAAGGTTT
AAATCTGACTAGAATAAGGATGCCATGCCCGNGCTGNGAAAAANCGAACATTTGNGTGGC
GTAAAGGGGAGAAGAAGAAGAAGAAATGCGGGGATAAGCGNGGGGGGCGACCGGCTTCTG
GGAGGGGGGAGNAACCGGGAAAAANCGGNAAGGGNACCNAAAACGGGGNACGGACACGGG
CTTACTCACACAAAAGGGATtaaaggggntnanatncctngccccgggncaagcanaaan
tccaaaatctttgggatnggcaaaccccnatttgaaacaaaaannattcccccnttttnc
aacggggaaaaaanannantttaaatnnnnngggggccannnnnaaaaaaaaaannnnnt
ttttcnncaggcnaaaaaggnantncc

CLOSE