Detailed Information [113278]
 

Strain Information
DGRC Number 113278
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}Vha16[NP3437] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
y* w*; P{w+mW.hs=GawB}Vha16NP3437 / CyO, P{w-=UAS-lacZ.UW14}UW14
Original Number 3437
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP3437
NP line. Received from the National Institute of Genetics.
Balancer CyUW14
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression yolk
Larval GFP gut
Larval X-gal epi, gut, mt, tr
Adult GFP distal? mouth, ant, tarsas. weal in all bristle. wg margin.
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np13035_0727
Flanking Sequence
antctttgggtgaaaaagcctttttttgtatacttncggtaagcttcggctatcgacggg
accaccttatgttatttcatcatgAGCGCGTGTGTGTGAGAGCGAGCAAAGTTACTGTGT
TTGGTGAAGTTTATGAAGCGCGCTTTCCTTTTCTCACAACAGTCACAAGACCGTTGGGAA
GTGTTGCCATATTAAAGTTTTTTCTTTTCATCTTGTTGGTTNNNGNTTGGGCACACAATG
GACTAGAAACCCTATTGAAGAACATAAAACCCTCGCCTTTCGCTCTTTGTAAACCCAATT
AACTGACTACTTATGATTCAATATTTATTGGTCGAACAACGAACAATAGTTGTCGGGAAT
TGCATGCCAAAGAAAAATCACATAAAAGACAACAAATNTTTTTGTTAAGGCGCGAAAGAA
GGATGAAGTATTTTCCTATCGATATCTTCTCCAGCCCAATTAGCAGACACTTATGTATGA
CCCAATGGNAATGATCGNAGAATACCATAANGAGAGNAACCCGGNGNCCAAGAACCCATT
ATTGGTGGGGGNCCCNTTTNANGGAAGGGGCAAGGCCNNTCCCGACATGTNNATNCCTCT
TTNAGACCCAATCAAATNCCTGGAAGAGGCTTCCCTGGGGCNTTAAAAANCCAACGGAAT
TNGGGGGAGNTTATNATNNATGAGCCTNNCCGNNCNAANCGANNCCAGNCAANNNGGNNT
TGNNCCTTGGTNNCTACNNTCTTCCGAGGANGATGGNGCACTTATTNTATGCTGNCNNAA
TGGNAGAGGNATATCAGCTCactnnccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)

CLOSE