Detailed Information [113288]

Strain Information
DGRC Number 113288
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}spin[NP3459] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}spinNP3459 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 52E7; -; 52E5
Map Viewer
Related Genes CG30095 spin CG8430
Original Number 3459
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP3459

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 798
General Information NP_lines
Lethality lethal
Embryonic Expression no bro, restain
Larval GFP ubiquitous, strong in pns.
Larval X-gal gut, mt, epi
Adult GFP internal. ubiquitous in pupae.
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np16685_0727
Strand Minus
Insertion Point 11193874
Chromosome Band 2R
Flanking Sequence
tttngngtgcactgaatttatgtgtatacttcggtaagcttcggctatcgacgggaccac
cttatgttatttcatcatgAATCAGCCTTTGCTTTTTAATTATTCCATTTTCTGGGTATT
TTCGCTCATTTCGCTTTGAGAAATTTATCGTACGATGTTTTTCGACCAATCAGCGTGTTT
GTTTGCCTTGCCTAGTGACGTAACGGTTGGGGGACGCCACGCGATAAGTCTGTGTGCGTG
TGTGTGTGTACTGCATTGCGATTGTGGACTGAGAGTGGCTGGCGGAGAGAGGCGGAGGGG
GGACACAGTGGGGCTGGTCTGGGTGAGGCATTCCTTATGATATATACATATGTATATTTA
TATTATTGCTATCTCGCACACTTAACGAGTAATCTCATTCCACGCAAGGAATTCCTAATG
TTTATGGGCACTTCTTGGCCAAAAACAAAAGAAGTCAAAGGAATACGTAGATACATACAT
ACCTCCCCTCTCATTACCATTTTTCCCCACTTTTGGGGGAAGTTCCGTCAATGTATTTAA
GTATTAGTANTTCTTTTTTAGCCGGCTGCCGCATTTTTAAGAACCCTGTTATCTCTCTGG
CCAAAATTCTCTCTTGGGTTGGTTCTCTCTGNGNCCCAATAACGCGACAGNGGGATCGCA
ATGCTAGGTTTATTACAAAAATATTTGGACTTCCCCAAAGGGGAACTTTNTGGAANCAGA
CATGACAGNNGGTTTTACTAAAGACTTTGAATGNTGTNCGTTTATCTAAAAAATTTTNTT
NCTTGGCAGTACAATTCCANagtcgaattttgaagggtttatttttcaatttnacgaact
tttttctntaaaaagccctgtctgnggcaanaaaatttn


CLOSE