Detailed Information [113289]
 

Strain Information
DGRC Number 113289
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}CG14213[NP3461] / FM7c
y* w* P{w+mW.hs=GawB}CG14213NP3461 / FM7c
Original Number 3461
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP3461

NP line. Received from the National Institute of Genetics.

Balancer FM7c
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression muscle
Larval GFP weak tr
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np11595_0727
Flanking Sequence
gttttttggnnnactanaccgnggggaaaaancccncctntttggnactnncggaaanac
ccccggctatcgacgggaccaccttntgttatttcatcatgACCAGGATTATGTTGTGTG
CCGAACAGTGTGGCCAGAACCGCGCAAATGCCGCTGGAAATTGGTGAAACGCAAGCGCGC
TATTTGTTTTCCAGCGTCGATGTAAATATGTACATAAATTTAAATTTTCAGAGAANNTTT
TTTTNGTACGAAAACACAAAGTCTGAATGAAATCAAACATGATTTGCCAAATACAACTGC
TTGCGCATGCTTTGTTGGTGCAAAATGCAAAAGTCTACAATTTTGAAGAAAATAGGCTTG
ATATCTTTGAAAAAGGATGACATTGCAAAGAAATAATGAATGGACGTGAGCGCGTGATTG
CGAATGACCGATGATTACATTgatcgaagaatacataagagagaaccgtcgccaaagaac
ccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcctcttca
gaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgtggagtta
tcatgatgagctgccgagtcaatcgatacagtcaactgtctttgacctttgntactactc
tcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcatatcagtc
tccactgagcatnnnnnnnttnggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnn

CLOSE