Detailed Information [113358]

Strain Information
DGRC Number 113358
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP3594
Genotype w*; P{w+mW.hs=GawB}NP3594
Original Number 3594
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP3594

NP line. Received from the National Institute of Genetics.

General Information NP_lines
Embryonic Expression cns + pns
Larval GFP cns, pns, DT node
Larval X-gal sg
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np12255_0727
Flanking Sequence
attttttgggtgcantgnntttatttgtatacttcggtaagcttcggctatcgacgggac
caccttatgttatttcatcatgGACTAGACGCCCAACAACTGACACCACCCCCGTTCAGT
CTGGCGATTCCACGTTCAGTCGCCTGGTATTTGCTACTTTTGTTGTTGTCGCTCTGCCTG
CTGTTTGTTTTTCACGTCTTGCGCCAACGCCAGCGTCGANTGCGGCGCCCCTTGCGGAGC
AGAGCTGATTGTCTGGCTATTTTCTGGCTATCAATTACAAGCCAGGTACAAATTCTCAAT
GGAAAATGTTTCCAGAAAGTATGCTATTATTTATTATTATTTCTGCTATCAAACGAAATA
TGTATGATTGCTACTGTAAGATTAATTTGTGGCATAAATTTAGTATAAGTACAAACAATA
ATAGAgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggt
ccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccat
gaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccg
agtcaatcgatacagtcaactgtctttgacctttgttactactctcttccgatgatgatg
tcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgagntnnnnn
nnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE