Detailed Information [113398]

Strain Information
DGRC Number 113398
Genotype with FlyBase Link w[*] P{w[+mW.hs]=GawB}RhoGAP18B[NP4129] / FM7c
Genotype w* P{w+mW.hs=GawB}RhoGAP18BNP4129 / FM7c
Break points/Insertion Site 18A3
Map Viewer
Related Genes RhoGAP18B CG7502 inx5 412{}165
Original Number 4129
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP4129

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 438
General Information NP_lines
Embryonic Expression cns (SG), a small # of cells
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np30335_0807
Strand Plus
Insertion Point 18882931
Chromosome Band X
Flanking Sequence
attttnggggcataaccccntttttngcttcggtaagctncggctatcgacgggaccacc
ttatgttntttcatcatgGGTGGAAACATACTATATTGTCAAAACAAAAAATAATATCCT
GTTTCGACTGTTGTGTTTTACTCGCTGCAATAATTGACGAACGGTGGGATATCGTTTTGA
TTTCATTTCGTTTCAATTATAATAAAAACATTTAAGGAANNNNCATCTTTGAATAAAGTT
ACGAATTTAGGGTTACTTCTCACAAACTGATAAACATAGTTAATTAGTTAGGTAATTACG
TAAAATAACAAAAGTGGAGGCGGATTTCCCgatcgaagaatacataagagagaaccgtcg
ccaaagaacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtca
tcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaatt
gtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgacctttg
gtactactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggc
atatcagtctccactgagcatntnnttttngggggnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaaaaaaaaaaaaaan

Image Files
Larval GFP

g1 (->Large)

g2 (->Large)


CLOSE