Detailed Information [113414]

Strain Information
DGRC Number 113414
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}CG9171[NP4226] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}CG9171NP4226 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 25F5; 87A3
Map Viewer
Related Genes CG14005 Hsp70Ab Hsp70Aa CG31913 CG3281 CG9171 S-element{}1293
Original Number 4226
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP4226

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1045 1451
General Information NP_lines
Embryonic Expression mesoderm
Larval GFP DT fusion cells in L3, epi.
Larval X-gal sg
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np31485_0907
Strand Plus
Insertion Point 5791761
Chromosome Band 2L
Flanking Sequence
attttanngtgcactgaatttaattntatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgGTTTGTAGCACAGTGTTGTGGCCCTGGAGAAAGAGAAAC
GGAGGAGACACGCAAAACAGAACGAGAAACTTTTACACTGGCCAACAAACAGTGTGAGAA
GGCGTATGGGTGCGGGGGGTGAGGTAGGGAGAGGCGCGGCAGGGCTCAGCTGATTCTGAT
TGGGATTTTCGGGCATGCCACATGCAGCGGCGGCAACAGCAGCAACAACAATAACAGCCT
CCCACTCTCGCGCTCTCTCACTCGCTCGCTCTCTTTGCTGCAAATCGAATTTTTTGTTGT
TTATTTAGGTGACGCTCGCACACATTGGCAAACATTTCAATCCGTGTGTGCTGCACACTT
GTTTTTCCTTCTTTAGCCCCGATTCCACGGCAATTTGTGCACTTCGCTGCCGTTCGGCga
tcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgtttt
caggaagggcaagccatccgacatgtcatnctcttcagaccaatcaaatncatgaagagc
atncctgggcataaaatccaacggaattggnggagttatcatgatgagctgccgagtcaa
tcgatacagncaactgnctttgacctttggtactactctcttccgatgatgatgtcgcac
ttattctatgctgtctcaatgttagaggcatatcagtctncnctnnnnnnnnntnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np56763_0309
Strand Plus
Insertion Point 7784180
Chromosome Band 3R
Flanking Sequence
gnnnggngggnnngnnngggggnggnngngnnngtttttggnnnnganncttgnggtcnt
naancccagtntacgttagtggntgtctcttgccgacgggnaccaccttatgttatttca
tcatgCGGCACACTATTCTCGTTGCTTCGAGAGAGCGCGCCTCGAATGTTCGCGAAAAGA
GCGCCGGAGTATAAATAGAGGCGCTTCGTCGACGGAGCGTCAATTCAATTCAAACAAGCA
AAGTGAACACATCGCGAAGCGTAAGCTGAGCAAACAAACAAGCGCAGCTGAACAAGNTAA
ACAATCTGCAATAAAGTGCAAGTTAAAGTGAATCAATTAAAAGTAACCAACAACCAAGTA
ATTAAACTAAAAACTGCAACTACTGAAATCAACCAAGAAGTCATTATTGAAGACAAGAAG
AGAACTCTGAATAGGTCGATAGCGTCAATGTCCGCCTTCAGTTGCACTTTGTCAGCGGTT
TCGTGACGAAGCTCCAAGCGGTTTACGCCATCAATTAAACACAAAGTGCTGTGCCAAAAC
TCCTCTCGCTTCTTATTTTTGTTTGTTTTTTGAGTGATTGGGGTGGTGATTGGTTTTGGG
TGGGGTAAGCAGGGGGAAAGNGNGAAAAANNCNGGNNNTGGGNCNNGAGGNNNNNNNNNN
NNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np12825_0727
Flanking Sequence
acttctttnnggttaaaaaancccttttttttnnncttcggnaagactncggctatcgac
gggaccaccttatnttatttcatcatgGTTTGTAGCACAGTGTTGTGGCCCTGGAGAAAG
AGAAACGGAGGAGACACGCAAAACAGAACGAGAAACTTTTACACTGGCCAACAAACAGTG
TGAGAAGGCGTATGGGTGCGGGGGGTGAGGTAGGGAGAGGCGCGNTTTTTTTNAGCTGAT
TCTGATTGGGATTGNGGGGCATGCCACATGCAGCGGCGGCAACAGCAGCAACAACAATAA
CAGCCTCCCACTCTCGCGCTCTCTCACTCGCTCGCTCTCTTTGCTGCAAATCGAATTTTT
TGTTGTTTATTTAGGTGACGCTCGCACACATTGGCAAACATTTCAATCCGTGTGTGCTGC
ACACTTGTTTTTCCTTCTTTAGCCCCGATTCCACGGCAATTTGTGCACTTCGCTGCCGTT
CGGCgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtc
cgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatg
aagagcatncctgggcataaaatccaacggaattgtggagttatcatgatgagctgccga
gtcaatcgatacaggcaactgnctttgacctttggtactactctcttccgatgatgatgn
cgcacttattctatgctgtctcaatgttagaggcatatcagtctcnctgagctnnnnnnn
tnggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE