Detailed Information [113417]

Strain Information
DGRC Number 113417
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}Glycogenin[NP4252] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}GlycogeninNP4252 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 57C9 - 57D1
Map Viewer
Related Genes CG15658 BEST:GH09393 Glycogenin
Original Number 4252
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP4252

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 896
General Information NP_lines
Embryonic Expression sg
Larval X-gal dorsal and ventral dots along AP boundary of wing pouch,
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2018-10-29
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np30715_0807
Flanking Sequence
GAAGGAGGGGANGGCNNNAGGAAAAAAAAAAAAAAGTTTTAAAAAAAAAGAANNAGATGG
GCACNGAAAAACGAGTNTTAGNNGNNCGGTAAGACTNCCGGCTATCGACGGGACCACCNA
ANGTTTTNGGAGGCANGCGCGGGGGGGGGGGGCGCNGNGGNGGGGGGGGGNNNNCNGGTT
TGNCCGNGGGGGGGGNNNNNCNGNNGGGGNNNGGGGNGGNNGGNNNGNNNNNGGCGCGNN
NGAGCNNNCGNGCGNNNNGNGNNNNNGACTANGGAAGCNTTCNNNTCNCGCGNGGNNNNN
NNCNNGNNGGGGGGGGGGCNCNNNNCNNNNNNNNNNGGNCNNNCGGNNNGNNNCNNNGCN
NNNNNNGGCCNGNGNNNNNNNNGGNGGNNCCGNNNNCNCNCGNNCCGNNCGNNNNGNNNN
NCNNGGNNNCNNCNNNCNCCNNNNNCNGNNNNNNCCCCNGNNNNNNNNGNNGNNCNNNNG
GNNGNCNNGCNNGNNNNNGNNNNCNCCNNNGNGGGNNGNCGGNGGGNGCGNNNCNGGGNN
NNNNGNNNNNGNNNGNNNNNGCGCNNNNGGNCNGNCNNGNNNGNNGCGNGGGGCNNGNGN
NNNNNNNANNCGNNGGNNGGGNNGGGGGGNGCNCNGNNNGGNNGNGNNGNGGNNNNNNNN
CNGNNNNNCGNNNNNCGNNGGNGGCNGCNNNGGGGGGCNNNGNCCCGNNNGCGNCGGCNC
NNGNNNGNCNNGNGNCNNCGGCNGGGGNGGNNCNGGCNCNGGGNGNNGNCNCNCNGCNCC
NNNCCCCNNGCNNNGGNNGGngggncngncggcggnncgnnncngcnnccgnnccgnccc
gcnnnnnnnnnnngangnnggggcnggnnccnngnnnngnngncnngngngnggnnnngc
gggacgngggggggcnccngggncgnnggggnnnnnnnggcgggnncncncnnnnanncc
nacngngccgaggnggnnncngnncggccnngnggnncgcnggggcnnngcgnnggnnng
gncgcccgnngncccnnnggcnngnccncggcggnggngngngnggnanccnnnnnnnnn
nggnngcngnggnggggggcggacgnnncgcggggggggggccgnnggncgcccgnnncg
ggcggccgcgcncgnggngnggcccnngnnggggaagnnncngngngggnnncnanancn
gancggnngngnnnnnncngcgcgggggcgaaannnncgccnccgannnccccnncgcnc
cgcaanangncnnnngcgggggcgcgcacggnnnannnnnncacgcggngngggnnnnng
nncnancgannncaagacanagcncgaaaaaaanaaaaaaag

Library Name / Clone Name np / np62283_0309
Strand Plus
Insertion Point 16244306
Chromosome Band 2R
Flanking Sequence
gnnnngngnggngggncgccgggggcgggnggncagtttttggnnngattcctgggggaa
aaacccgcantttgcgttagtggnagcctcttgccgacgggnaccaccttatgttatttc
atcatgCTGAGAACTGAAAAGNCGATAGAAAACAGCCTGCCCTAAGNTAAAGCTCCTTTG
GCGTTTCCTGCTAATCAATCAATCAAGCAACAAATCGCCTATCCTTCCATTTCGTAACAC
TCGCTTCAGGTTGGAGTTATGCAAAATCCGAATTCGATTTGAATGCAAAATCAGAAGCTG
AATCGAAATCATAGCGATAATCCCACTACTATAATATATATAATTATAAATCGAGCATAG
AGCGCGCGCGATGTTGGTGTGGCTACGACCTTTACTGACCTTCACTAGCGTACGACTCTG
CCCACGGCCCCCCGCCTCATCACCATCACCGNCACCACCCCCTGNNNNGNCGCTCTCTCC
CTTCGCTCTTAGNNNCTCTCTATTNNGAAACACTAACGNGCAGGAAAACATTTNAAAAAN
GCGAACATTGCACTGGAAACCGAACCGNTGNCAGNCAGNCGNCNGGCATATNNGGNNGNN
TATGAAAAGGNNGNGCACAAAANCGNTGATAACGNGAAGCNNACANAACCNNNAAGAANA
GAGAGAGAGAGAGAGANNNNNGGGGAGAGAGAGGGNGCNNACAGNNNNGNNAANNCCGNN
NNGGNGGGANNNCANNACANNNANNNNNGNGNNNNGNNCCNGGNNNAANGGGGGGGGGGG
NCCCANNNANNNCCANGNNGngncannnannnncnnnnnaananncnnncnccnnaaaan
naanggnnanannnnccnnnnnnnnnnccannggaaaagggggccnnnnangggnggcnc
nnnnnnnngggnnnnnnaaaancannnnnngnnnnnngggnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)
Larval GFP

g1 (->Large)

g2 (->Large)

g3 (->Large)


CLOSE