Detailed Information [113446]

Strain Information
DGRC Number 113446
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP4419 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP4419 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 85B7
Map Viewer
Related Genes osk pyd
Original Number 4419
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP4419

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1396
General Information NP_lines
Embryonic Expression cns + pns (subset)
Larval GFP uniform epi, tr
Larval X-gal ch organ, epi, cns,
Adult GFP ubiquitous. strong in distal appendage.
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np13945_0727
Strand Minus
Insertion Point 4757625
Chromosome Band 3R
Flanking Sequence
acatcttgggtgaaaancccctttttttntacttcggaaagcntcggctatcgacgggac
caccttatgttatttcatcatgGTTCAGATTATCGCGCTTGTGCGGTTGTGCGGAGCGGA
CGAGTTGAAATGGCCGAGTCGTGAACTTGAAATCTATACAGGCGTTTTAAAACATAAACA
AACAAATACGAATGCGAAAGAGCCGGTAAAAGTTTAAATGTTTNNTCGAAGAATACATAA
GAGAGAACCGNCGCCAAAGAACCCATTATTGTTGGGGTCCGTTTTCAGGAAGGGCAAGCC
ATCCGACATGTCATCCTCTTCAGACCAATCAAATCCATGAAGAGCATCCCTGGGCATAAA
ATCCAACGGAATTGTGGAGTTATCATGATGAGCTGCCGAGTCAATCGATACAGTCAACTG
TCTTTGACCTTTGTTACTACTCTCTTCCGATGATGATGTCGCACTTATTCTATGCTGTCT
CAATGTTAGAGGCATATCAGTCTCCACTGAAGCCATCTTNNTTNTGGNNNNNTNNNNNNN
NNNNGANNNNNNNNNNNNNNNNNNNNTNTNNNNNNNNNANNNNNNNAGNNNNNNNNNNNN
NNANNNANNNNAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnn


CLOSE