Detailed Information [113469]
 

Strain Information
DGRC Number 113469
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP4489 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP4489 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 70D4
Map Viewer
Related Genes fz F-element{}994
Original Number 4489
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP4489

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1901
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression muscle subset, cns
Larval GFP prox circle in wg, hal. tr node, pit.
Larval X-gal outer half ring of wing pouch,
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np31625_0907
Flanking Sequence
GNNNNNGNNNNNNNNNNNNNNNGNGNNNNNNNNNNNNNNNNNNNNNNTNTTTTTNNNNNN
NNATNTTTTTTTTTTCGAGACGNTTGGGNNCCCNNCTTNGGGNNNNNNNAATANAAAAAA
AAANNNNNNNNNNNNNNNNNNTNNNNAAAAAAAAAAAAAAAAANNTNNGGGGGGGGGNNN
TTTTTNNNNNNNNNNNTTTTTTTTNAAAAAAAANNNNNNNNANNAAACCCCCNTTTTTNN
NNNNNTTTNNNNNNNNNNNNNNNNNNNNCNGNNGGGNNNNNGGGGGGGGGNNNNNNTTTT
TTNNNNNNNNNNNNNNNNNNNNNNAAAAAAAAGNGGNGNAAAAAAAAANNNNNCCCCCCC
CCCCTTTTTNNNTTTTTNNNNNNNNNNNNNNCCCCCCCGGGGGGGGGGGGGGGGGNNNNN
NNNNNCCCTTTTTNTAATCCCGGGNAAACGGGGGGGNCNANCCCCCAACCCCCTTTTTTN
NNAAGGGTTTTTAANAANTTTTTNCCCNANAACCCNAAANGGGGGGGGCCCCCCCCCCCC
CCCCCCCCCCANAAGGGGGTTTTTTTTTTTTTTTTTNCCCCCNAAGAGGTTTTTTTTTCC
CCCCCCCTTTCCCNAAAAATTTTTTTTNGGGGGTTTCCCCCCCAAANAGGCCCGGGGGTT
TTTNAANATGGGGGCCCCCCCCCCTTTTNAAAACCCCCCNAAAGGGGGGCCCCCGGGGGG
GGAAANAAAAGGGGTTTGGGGGNCCCCTTTTTCCCGGGGGGCNGGGGGGGGAAAATTTTN
GGGGGGAAAANTTTTTTTTTncccggggnaaaaccctttttcccggggggaaaaaaaaac
ccctttccccccggggggggggcnntttttnccccccgggnggttttttttttttttttt
cccccnggggggcccccctttttttttttttttnaaaaaaaaccccggggtttaaaaaag
gggggttccccccccccccgggggggggggncccgggnaaaaaaaaaaaaaaaaaaaaaa
aaaatttttgggggnaaaaaaanaatattttccccggggggganaaaaaaaattttttcc
cccccccgggggggggggggggggtttttttttgggggggggngntcccccccaananan
naaagnnnnnnaaaaaaattttttttnnnnnnnnnnnggggg

Library Name / Clone Name np / np62543_0309
Strand Minus
Insertion Point 14223213
Chromosome Band 3L
Flanking Sequence
ttttactcgcacttattgcaagtatacgttaagtggatgtctcttgccgacgggaccacc
ttatgttatttcatcatgCATGGGGCTCTTTCCAAGCCGCTCTCTCACCGTATCGTTCTC
CTGCTCACACGCTGAATATGCGCTCTTTCGCTCGAATGGTGTGAGAGGAGGTTTTATTCA
GCTATACGCTTTGTAGTATAGCACTGGGGGCGACCTTGAATNTGACACTCTCGGCGGGAG
AGCCAGAGAGCCAAAGAGAGCGAAGTGAAAGACAGGGCTGTTATGCCTTTTGTTTGGATG
CTGTCTCGCTCGCACTCTGTCTCCTCTCAACTTCTTGGCCTCCTGTTGATTAGCAGACAG
GAAAAAGAAAGCATCAACAAACAACTAAATAAGAGACCATTTAANTAATTAGAATTCAAG
ATGATTATGCAATCGACAGGGCTAATAGGGAAATTAGGGGCGGAAGCTGTGCCCAAATCT
AGGTGTTGGGCCCGCTCAATGGAAATTTGAACATCGATATTCACTTTGTAAATACTTAAA
TATTTATAGATTCCAATNTAAATATTAATTAATTAACCATTNTTTCGATATAATAAAATA
TAACCAATCTTATGCTTATNAAAATTAATAAAAGAAATAAGTGCTGNATTTAAAAAGGCT
CTAATTTAAAAAGACTAGAATCATTTTGCCAGCAAAAAANNCCTTGCTGNAATGGGATCA
TATCCNAAAACGAAANNAGTNTCCACNTTATGNCCGAANGGNAAAAANNACNGNNCATGN
NAGNTAAAAATTTTTTAANNttntaaaangnatattgntanggnaccncccctnctttnt
ttttaatnantccannnannccngnnnnntnnccanngnttttgtatntnacnnnnncan
ggcccgnnnnaaaaantanccccnccngnaaaaaccnaaaaaaangattttnaaccnnnt
nnnncnnnaaaa

Library Name / Clone Name np / np14565_0727
Strand Plus
Insertion Point 14223206
Chromosome Band 3L
Flanking Sequence
ggggaaagnggtgntatgttaactntaggatcnangttnngtaattgntcttanactggg
gncnnncggaaaacccnggctattgacgggaccaccttttgttatttcatcatgGCCCCA
TGTTTTCAGTTCCTCAGTTTGTCAGCGTATGCCCTACCATGCGGATGTGCTCGCGGATTG
ATTTCGACTCGAACTTCCGGCTTCCCGTTTTTTNCGGTNNTTTTTTAAANCGGNTAAANG
GTCCCCCCCCGGGGGGGCCCNGGNAAAAAANAAATAATAANTTTTTGNGGGGNNNNNNNN
NNNNNNNAATTCNNANTTTTCTNNNGTTGGGGTCAANGTNATTTNNNTTTTTTTTTNGGG
GGGGGGGGGGGGGNTNCNNAAAAAAANGGGGGGAANAAANNAAAGGGAANATTNAAAAAA
AAGNGGGGGGGGGGGGNGNTAAAAGNGNNNTNNNNCNGCNTNAAGNGGGNCNCNTTTTTT
NTGNTGGGCNAANCCNANAANAAAAAAAAAAGGGGGGNGGGNNTAAAAAAAAAAAAAAAA
CCCCCNCCCNGNGGGGGGGAAAAAAAAAAAACCCCCCCNTCTCTTTTTTTTTTTTCAAAA
ACCCCCCCCNAAAAAAANANANATNTTTNNCNNAAAAAAAAAANTTTTTTTNNTGNNCNC
NCNCAANAAAAANAGAGAAGGGNGNGNTNNTTTTNATAGNAGGGGGGGGGNAAAANNANA
NNANGAGGGGGGGGGGGGGAGANANAAAAAAAGAAANGNGNNNANNNNANNAAAAANANA
AAGAAGAAAGAAGAANACCCccccccncnatnaaagannanaagaagagnanggaaaaaa
nnnnnntnttttttttnttnntnnngngggagggagananaaaaaanaaaaaattntnnc
gccgcngcgngcgnnnnnataaaanaanaaaaagagagnnggnngnnnagngngngnggc
ccccccccccc

Image Files
Disc

d1 (->Large)

d2 (->Large)

CLOSE