Detailed Information [113473]

Strain Information
DGRC Number 113473
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP4507 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP4507 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 87A3
Map Viewer
Related Genes Hsp70Ab Hsp70Aa CG3281 S-element{}1293
Original Number 4507
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP4507

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1451
General Information NP_lines
Embryonic Expression muscle subset
Larval GFP all tr
Larval X-gal AP boundary outside of pouch, epi, hg, cns,
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np14835_0727
Strand Minus
Insertion Point 7784187
Chromosome Band 3R
Flanking Sequence
aggggccnanngtgttatgtttttttgttaggatncancnngtgtcaaaaacccgtantt
gggnggncggaaagactccggctatcnacgggaccaccttttnttatttcatcatgGTGT
GCCGTTTACTGTGCGACAGAGTGAGAGAGCAATAGTACAGAGAGGGAGAGTCACAAAACG
AATAGAGAATAACGGGGGGCCGCTCTAGAACTAGTGgatcgaagaatacataagagagaa
ccgtngccaaagaaccnnttattgttggggtccgttttcaggangggcaagccatccgac
atgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaanncaac
ggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttga
cctttgntactactctcttncgatgatgatgtcgcacttattctatgctgtctcaatgtt
agaggcatatcagtctccactgaagccaatcttatnctggggggnnngcntnnnnnntnn
ggnnnntgnggncnngnnactnaatgnnacanttngngtgnggggggggnnnnnnnttng
nngnagngnnggggngnnnnnnnnnngnnnnnggggnnngtgnnggnnntnnnnnggnnn
gggtggnntanngnnnnngnnnnnngnnggnnnnnnnnnnnnnnnnnnnggggnnnnnnn
nnnnngnngnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnngnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnttnnnnnnnnnnnnn
gnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnan

Library Name / Clone Name np / np31805_0907
Strand Minus
Insertion Point 7784187
Chromosome Band 3R
Flanking Sequence
tttttnaacgtgcactgaatttaantgtatacttcggtaagcttcggctatcgacgggac
caccttatgttatttcatcatgGNGTGCCGTTTACTGTGCGACAGAGTGAGAGAGCAATA
GTACAGAGAGGGAGAGTCACAAAACGAATAGAGAATAACGGGGGGCCGCTCTAGAACTAG
TGGATCNAAGAATACATANGAGAGAACCGTCNNCAANGAACCCATTATTGTTGGGGTCCG
TTTTCAGGAAGGGCAAGCCATCCGACATGTCATCCTCTTCAGACCAATCAAATCCATGAA
GAGCATCCCTGNGCATAAAATCCAACGGTATTGTGGAGNTATNATGATGAGCTGCCNAGT
CAATCGATACAGTCAACTGACTNTGACCTTNGGTACTACTNTCTNCCGATGATGATGTCG
CACTTATTCTATGCTGTCTCAATGTNAGAGGCATATNAGTCTCCACTGAGCATNNNNTNN
TGGGNCCNNNNGGCNTNNTTATTNNNNTCATGCNGNCANTTTANTNAATTTACANTTNGG
GGGNNNGNNAGNTTTGCATTCNCATNATNGNNNGNNNNNNAANTTTNGNGNNNCCTGNTT
NTTGNGGNCNTNNTTTTNNCCNCTGNCNTNCTGGGCCNGTTTTTGNNGGNNNNTTNNNNT
TNNNGNGNNANTTTNANNGGGNNTNNNATNNNNNNNNNGNGNCCTNNTTTTTCCCCCNGN
NCCCCTTTATTNNNNNNNTNNNNNNNTNNNNNNNGNNCNNCNTTNNNNNTTNNTTTTTNT
TTNNNNCNNNNNCNNNNNNNgnnnnnnnnnnnnnttnggnnnnaannannaanncnnnnn
ggnnnntnnnnnnttnnnnnnnnnnnnntnnnnnnnnnnaanttnnnnnccncttttttn
nnnnnnnnnnnnncnnnnnnnnnnnnttnnnnccnaaannnnnnnaaan

Image Files
Disc

d1 (->Large)


CLOSE