Detailed Information [113524]
 

Strain Information
DGRC Number 113524
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Baldspot[NP4796] / TM3, Sb[1] Ser[1]
Genotype w*; P{w+mW.hs=GawB}BaldspotNP4796 / TM3, Sb1 Ser1
Break points/Insertion Site 22D1; 73B5
Map Viewer
Related Genes Galpha73B CG15383 aop Baldspot snRNA:U12:73B
Original Number 4796
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP4796

NP line. Received from the National Institute of Genetics.

Balancer TM3 Sb Ser
Cluster id 1000 1938
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression asp. psp (SG)
Larval GFP gut
Larval X-gal sg, mg
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np29255_0807
Strand Plus
Insertion Point 2158547
Chromosome Band 2L
Flanking Sequence
ACANCTTGGGGGGNAANGCCTTTTTTTGGNNCCTCGGGNAAGCCTTCGGTTTTCNCGGGA
CCCACCTTNTGTTATTNCNTCATGTNCATAACAAGCGCGTGAGCGTATCGGGTTTGCTAT
ATTGTGTTTGCCCTCGGTTGGCTGNGTTGGTATNTTGGTACAAAAAGCAAGAAAAAAAAT
ATAAATAAAAAACGCCAATACCGGGTTCNTCTNCGCAACAAANNTTNGNGAAAAAGTATA
TGGAAAAAGTATGCGAAGACGCAGGGGGAAATAAAGCCAAATGTCTGCGGTTCATTTTCT
GTCTAGATCGAAGAATACATAAGAGAGAACCGTCGCCAAAGAACCCATTATTGTTGGGGT
CCGTTTTCAGGAAGGGCAAGCCATCCGACATGTCATCCTCTTCAGACCAATCAAATCCAT
GAAGAGCATCCCTGGGCATAAAATCCAACGGAATTGTGGAGTTATCATGATGAGCTGCCG
AGTCAATCGATACAGTCAACTGTCTTTGACCTTTGTTACTACTCTCTTCCGATGATGATG
TCGCACTTATTCTATGCTGTCTCAATGTTAGAGGCATATCAGTCTCCACTGAAGCCATCN
TNANTCTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNTNNNNNNNNNNN
NNNNNNNCNCNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
tnnnnnnnnntnnnnnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnannaaanaann

Library Name / Clone Name np / np70645_0810
Strand Minus
Insertion Point 16610498
Chromosome Band 3L
Flanking Sequence
gtnnncgtgcactgnanttantgtatacttncggtaagcttcggctatcgacgggcacca
ccttatgttatttcatcatgAGCTAAACGTTCAGTTCGCTTTGCGCCGGCAAATTCGATA
GTTTTTTGAGTTTGCTGAACCGAGTCGCTGGGGCAGAAGTGTGTGACAGCCAGCCGTGTG
TGTTGTGATCCAANAATACATAANAGAGAACCGANGCCAAAGAACCCATTATTGACGGGG
TCCGNATTNAGGAAGGGCAAGCCATCCNACATGTNATNCTATTNANACCAATCAAATCCA
TGCNAGAGCATNCCTGGGCATAAAATCCAACGGNATTGTNGAGTTATCANGATGAGCTGC
CGAGTCAATCGATACAGACAACTGNCTNTGACCTTTGNTACTACTCTCTTCCNAAGATGA
TGTNACACTTATTTCTATNCTGACTCAATGATAGAGGCATATCAGTCTCCACTGAAGCAT
NTNNTNNTNGGGNNNNNNNNNNCNNNNNNAGANNANCNNNNNCCNNANNACCCNNTTNNN
GNNNNGGNNCNGGGNNNAAGAAAGGNCAANNAANCCNTNNNNAANNCNNNTNNNNNCNAN
NNAANNNNNNNNNGNNCNTNCNNNNNNNNNAAANNNCNANGNNNNNNNNGNNNNNNNNNN
NGNNNANNNNNNNANNNAANNNNANCCNNNNANNNGNNNNAGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNGNNNNNNNN
NNNNNCNNNNAGNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnn

CLOSE