Detailed Information [113614]

Strain Information
DGRC Number 113614
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}CG13204[NP5174] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}CG13204NP5174 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 47F6; -; 47F7
Map Viewer
Related Genes CG13204 Gr47b
Original Number 5174
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP5174

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 678
General Information NP_lines
Embryonic Expression muscle. not in discs
Larval GFP ubiquitous discs, genital. Not in abdominal histoblasts. CNS.
Larval X-gal ubiquitous in eye, wing, leg.
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np45655_0912
Flanking Sequence
NACNNGGNGGNGAAAAAAAAAAAANNGAAANCTAAAAAAAAAANCTCCAACGGGGGNGCC
AAAAAANCCCCCTNTNGNGGAGACNNNNGGGAAAAAGCCCCGGGCNANNCGGAGGGGCAC
CACCCTCNCATGNNGAGNCANACNCACGGNNNNCNACNGCCCGCNGCANAGCNGCCCCCA
CAAAANNNANNACAACACCCGGNACAGCCCGACNNGNAGAAGAANACCAAAGCCCNCGCC
GNNNGCAGACGAGGCACAGCAAAAAGGNCNAAAAGCCGNCCCCACNAACCNANGCAANAA
CAAAANCNCGAGNCANGAANGCNAAAAAGACCNNNCAATTGGNNGAGAGGGAAACCCAAG
AACNCAACAAANNAGGAGGGNAGNNNACNNNNNCACGNAAACCANACCCNNANCNNNCAN
ACACCNNCCCACCCNNCCNNCCCCANANCNACGCNACNAACACCCCNAANAAAGNNAAAA
AAACNNAACANNCNAGCNNNGCCNNANNGNNANAGAGGCAACAGNAAACCAAAANCAAAN
AAAAANAAAAGANANCGAGACAGGACGNGAGNAAAAGNGCGCACAACAAAAAAAACACCC
AACCCCGANAGGCAAAAACNCCGGACACGAGGAAAGGCNCCCACACCCANNAAAGGANCA
ANNAACACAANAGNGAAGNAAACAAAAGCCACACAAGNACNAAAAAAAAAAAGACNACAC
NCAANAAAAAAACNAAAAAAGAAAAAANAAANGNAANCCACGCAANGGAAAAAAAAANAN
AACCAAAACANAAAAACACAcaccnccccccaaanncaananncccaanaangngaacnn
cacacacccancgcaaacaacacaancaaaagacnanaaaagcgaaacannnagaaacnn
aaacanaaaaaaaaaaaaaanaaaacggaaacccacacaangccaacaaaaaaacggncn
ccagnnancngnnggcngnnaaacccgcccanacnacaaaaacggcaaaacaagngagan
cacnaacagacgcccnacncgnaacacgcngancaagcacgaaaaaacaananaaggaaa
angcngggcgaaaaaagcnaannngannaaacaaccgaaaaaaaangaaaaancagcacc
acaanacgnncgaaaacaaaangggacnaaagacaaaagcaccnacgcnaaaaagacaag
annaccaaannacacaaataanacacaccaccaccgnaggancanacaaaagaaagcgcn
caaaaccgcaccaacacacgaacaccaganagaancanaaccacacgggcgcncacagca
ncganagnggagncgncncanaacacanananacnanaaaacaanacgcnaacanaagac
ntgcncngaanccgcgnccgccncccnnnccncaanacacnaaancannnnaagcacaca
cacanaacacagnaagcacgnacganccaaaannccacgaacacacncagaaacncacan
aggagnaagaaacaaagacnngngagaananaaacacaacacg

Library Name / Clone Name np / np66193_0309
Strand Plus
Insertion Point 6431571
Chromosome Band 2R
Flanking Sequence
ttctttttactgcgcacttattgcaagtcatacgttaagtggatgtctcttgccgacggg
accaccttatgttatttcatcatgGAGGCGACCGAAAAATAAGAAGCTTGCCGAAACCGT
TAGCAAAGCGCCGTTAGCATGAAGGATGTGAAAGTGGCGCGCGCAATTAGCGAGTCCTCG
ACTACGTCAGATAACACCTCCGATTTCATCGAGATCCTCTAGCTAGNGGCTTNGGCCACT
AGNGGATNATGNATCCTNTAGCTNNAGACTNTGATTTCNTCTAATTAATATTATGAGTTA
ATTCAAACCCCACGGACATGCTAAGGGTTAATCAACAATCATATCGCTGTNTNNCTNNTA
CNGNNNNNNNANNNNNNNNNTNNNTNNNTNNNNNTNNNNNTNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)

d2 (->Large)

d3 (->Large)
Larval GFP

g1 (->Large)


CLOSE