Detailed Information [113653]

Strain Information
DGRC Number 113653
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP5260 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}NP5260 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 56E1
Map Viewer
Related Genes CG18367 sm
Original Number 5260
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP5260

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 874
General Information NP_lines
Embryonic Expression scattered cells. head.
Larval GFP all tracheal
Larval X-gal oenocyte. not in discs. (s.g.)
Adult GFP strong uniform stain in thorax, wing, leg. weaker in abd and head.
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np49525_0912
Strand Minus
Insertion Point 14695882
Chromosome Band 2R
Flanking Sequence
TTCGGNAGCTTCGGCTNTCGACGGGACCCCTTATGTTTTTATCATGGCCCATTACATGTA
TTTGTGAGATATGCGCGAGAAAGCAAAAGAGAAACAAACCTCTCTTCGATTGTAACTCTT
TTACCAGCAGTTTCTGTGCAGAGCAGCATTACAAGCGCAAAACTCGCGCCGCACTACTCG
CACACATTGCGCAGCATGTGCGACTGTATCGCTCTCACAAAGGCAGTACAAAAATAATAC
AGCTCTCATTTTCTCATTACGACGTGCGGTAGCGCACGGTGGGCAATGAAAGCACCACAA
GTCGTAAATATATTGAGAGGGATCGAAGAATACATAAGAGAGAACCGNCGNCAAAGAACC
CATTATTGNTGGGGTNCGTTTTCANGAANGGCAAGCCATTCGACATGTTATTCTTTTNAG
ACCAATCAAATTCATGAAGAGCNTTCCTGGGCATAAAATNCAACNGAATTGGGGNGGTNT
TATGATGAGCTGGCCNGTCAATCGATCCAGNCAACCGGCTTTGACCCTTGGACTACCCTC
TTTCGAGGAGGAAGGCCCNCTTNTTNTNTGCTGGCTCAAGGTAGANGNATATTAGTCTCC
TNGNTNNNTTTTTNNGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Embryo

e1 (->Large)

e2 (->Large)
Adult

a1 (->Large)


CLOSE