Detailed Information [113658]
 

Strain Information
DGRC Number 113658
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Vha16[NP5271] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
w*; P{w+mW.hs=GawB}Vha16NP5271 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 42C1
Map Viewer
Related Genes Trap1 Vha16 invader1{}757
Original Number 5271
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP5271

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 536
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression stripe ~stg 12subset of hg.
Larval GFP gut, anal pad
Larval X-gal gut. epidermis. not in discs. (s.g.)
Adult GFP internal.
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np49615_0912
Strand Minus
Insertion Point 1693474
Chromosome Band 2R
Flanking Sequence
GNNGNNGNGGGNGGGGNGNCGGCCCGGGGNGGGGGGNAGGTNTTTGGNNGGACNCACGGG
GGGAAAAAACCCCCNTTGGGGGNNNCGGAAAACCCCGGCNANCGACGGGNACCACCNTTT
GNGAGNNCANCANGCNCCGACGGGCCAACNCNCGANNAAAAAGNANANNNAAGAAGAGGC
CGNGAGCGGCCACNCGCAANNCGNNCGNCGNCGCAGCAGCANNGGNCGCAGAGCAGCGNA
AAACCCCACGNANANAGCACANANANNGNACANANAANAAAAANACNNNGNNNCGACGGG
GGGCAACGCANACANANAACGAGCGCGCANAACANNCAGANNCANNCNNGGNGCCAAAAC
GCCGAANAAAAACNANAGNGCAANCACCACAGCAGCAGCAAAACGAACNAAAANNNCGAN
NNCNCANCANNNGGAGCCNAAAAAACACACAACAAACAAAGCAAAANGNCNNNCNGAAGG
NGAGCAGCGGACAACCCCANCNNANGGCCCCNNCNNCGGAGNANGGGAGCCGCCNCCGCC
ANCANCCNNCNCGGGNAAGGNNNAAAANCAGGACNAGAAAAAAGGAGGCCAAGCCCCGGG
CCNGGGAAAAAACCGAACAANNNGGGGGGCGGNAAAGGGGNNGAAAAAAGAAANNANGGG
AAAAGGNNNGGGGGGAAAAAANNGNGGGGGGGGNGGNCCCCGGGGGGNNNNNNGGNGGGG
GGGGGGGGGGNNNNNNCNNNNGGGNAAAAAAANNNGGGGGGNGGNNNGGNNNNNNNCNNA
NAANANAANNNNNNNNGGNNnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnncncnnn
nnnnncnnncnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnnnnnncgcggnnnnnnnnn
nnnnnnnnnnnnnnncnnnncnccccnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnncn
nnnnnnnnnnnnnnnnnncnncncccccccccccccccc

Library Name / Clone Name np / np67923_0309
Strand Plus
Insertion Point 1693333
Chromosome Band 2R
Flanking Sequence
nntcttggggcacnaaaacccaagnttttgtgaagtggatgtctcttgccgacgggacca
ccttatgttatttcatcatgAGTCGGAGCGAGTGGCCAACAACGAAAACTGGGAGAGAGC
AGCAAGAGAGAGTGAGATTGAGCGAGAGGCCACTCGTCGGATTATTGCGCTTGTGTGGAG
TGTGACCTGTGTGCATGTGCATGTTGTCATGTGCTTGTGTGCGCTNTTTTANTGAGCGCA
TGACAGGCACACATCACGGATAGTAAGTCCAATTGGCAATGACAACGGTCTGGAAAATTA
CACACGTACACACAATCACATGGGAGCTGTTAAAACCCTGGTTTCCAGGCTTTTGCAAAA
TGAAAATGCAATTTTTGCACTTTCTGAAGATGCCTGTGCTCCTTGTTCAATTCCCATTGC
TCAACGCGCAAAACTCACACTCACAAGGAATCTCATTGTCATTGGCTAAGTGTGGCTTGC
CTGTGTGTGTGCATGTCGTGGCAGAAAATATTGTACAATTTTTTTTCTGTTTGAACTCTG
TTCAAATTCAAGTTGTCGCAGCAGCATGTTTTATCGCAGGCCCGAAACTTTTCCGCAGGG
CTAGCCTCACATGACCGCCTATCTTTTGACTGCTTTTTCACTCACGTGATTAGAAATCTA
ATTAAAAGCAATTCGCTGCTCTGTGGCCTCTTCGGGTTACTGCTGGCTGCTGCTTAAAAG
CGCGGATCCTCTAGCTGGNNNNTTTGGGNCNNTNNNGNNNNTNGGANCCTNTANCNAGNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Embryo

e1 (->Large)

e2 (->Large)

e3 (->Large)
Adult

a1 (->Large)

CLOSE