Detailed Information [113674]

Strain Information
DGRC Number 113674
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}spin[NP5311] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}spinNP5311 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 52E7; -; 52E5
Map Viewer
Related Genes CG30095 spin CG8430
Original Number 5311
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP5311

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 798
General Information NP_lines
Embryonic Expression CNS
Larval GFP CNS
Larval X-gal not in discs. (s.g.)
Adult GFP irregularly distributed large cells, internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np38425_0907
Strand Plus
Insertion Point 11193809
Chromosome Band 2R
Flanking Sequence
TTNTTTGANNCTTCGGAAGCTTCGGCNATCGACGGGACCCCTTATGTTATTTATCATGGG
CTGATTACTGCAACTTGGCTGCTTCGTGCCACGTTTCGCTTCGGTTCGCGGGGGTTCGTG
GAGCTTCGGCTCTCTCTCTCTCTTGAGGTCTCTTTGCGGCTCTCTTTTTCGTTCGCTCGC
TCTCCTTCTTTGGGGCACAACTTGGTGAGCTTTCTGNGNGNCATTGGTGGTGCTGGTGCA
TTTGCCGGCTTCTGATCTAAAAAANCATGNGNAAACATCCGTTACCAANNACCCATTANC
TGGNAACGNCCACATTTAAAGANAGGGCCNGCGTTCAAANTTGGNGNCCCCCAGAAANCN
AAAAAANNNANNGANNGCNCGCCAANCCCATAAAAGGCCAANNGCCCTTTGAGACACCCN
NAAAAACANCCCNCCNAAAAAACCCTTTCNGGCCNCTTTNTTTTGGCCCCGAANGGGANA
CCCCGGGCAAAAAAAAAGCCAAANGGGNNAACATTANATTTTTTNTNGAAAANNNAGNGC
CCCAAAAAAANNAAAAAAAANNGCCNCCGGNACCCTANTNNTTTTTNGGGNCCNCCCCCC
CCCCCCCNCANAGNAAANGGGGNNCCNACCNCCCNTTTTNNNTTTTTCCNAANAAGNNNN
CNNNGGGGGNNANAAAANCNCCCCACNNGANCNCTGNNNNTNTTNNNNNNNNNNCNCCNN
CCCCCCCNNANTCACCCTTATAANAANNCNNCNNNNNNTCCCATANNNACCCCNCCCCCN
TTNNTACNAAANNNANAANNnccnnntttttttttnntctntccccccaannggananan
cncctttaccccctccccnnnncccnncnnttntcctnnnncannnnnnnctnttnnncc
cnnaccncnnntcnntannnnntttntttnttncacnnaannntnntnntncnnnnnttt
ncccccccccccnat

Library Name / Clone Name np / np64353_0309
Strand Minus
Insertion Point 11193874
Chromosome Band 2R
Flanking Sequence
ttttncntncgccttnntgcagtctacgttagtggntgtctcttgccgcgggnaccacct
tatgttatttcatcatgAATCAGCCTTTGCTTTTTAATTATTCCATTTTCTGGGTATTTT
CGCTCATTTCGCTTTGAGAAATTTATCGTACGATGTTTTTCGACCAATCAGCGTGTTTGT
TTGCCTTGCCTAGTGACGTAACGGTTGGGGGACGCCACGCGATAAGTCTGTGTGCGTGTG
TGTGTGTACTGCATTGCGATTGTGGACTGAGAGTGGCTGGCGGAGAGAGGCGGAGGGGGG
ACACAGTGGGGCTGGTCTGGGTGAGGCATTCCTTATGATATATACATATGTATATTTATA
TTATTGCTATCTCGCACACTTAACGAGTAATCTCATTCCACGCAAGGAATTCCTAATGTT
TATGGGCACTTCTTGGCCAAAAACAAAAGAAGTCAAAGGAATACGTAGATACATACATAC
CTCCCTCTCATTACCATTTTCCCCACTTTTGGGGGAAGTTTCGTCAATGTATTTAGTATT
AGTATTCTTTTTTAGCCGGCTGCCGCATTTTTAGAACCTGTTTATCTCTCTGGCCAAAAT
CTCTCTTTGGTTTGGTCTCTCTTGTGCCCAANAAACGCGACAGTGGGATTCGCAATGCTA
GGGTTTTAATTACAAAANAATATTTTGGACTTCCCCCAAAGGNGGGAACTTTTTTGGAAA
ACCACACAATGACAAGGGGGTATTTTACTAAAANACTCTGNAAAGTATGTNNCGTTTTAT
CTNCAAAAANAAATTTTTNTtactttgggcggtncaaaattccagaagncgaaatttttg
aagggggtttatttttttcaatttcaacgaagcttatttctttnaaaaaggccctg


CLOSE