Detailed Information [113676]
 

Strain Information
DGRC Number 113676
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Gug[NP5315] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype w*; P{w+mW.hs=GawB}GugNP5315 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 66C13; -; 66D1
Map Viewer
Related Genes CG6915 Gug CG6983
Original Number 5315
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP5315

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1828
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression part of midgut, dorsal and lateral muscles,
Larval GFP tracheal node in early L3, subset of dorsal muscle.
Larval X-gal oenocyte. not in discs. (s.g.)
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np49935_0912
Strand Plus
Insertion Point 8414180
Chromosome Band 3L
Flanking Sequence
gnggngngnnnngnnaggggnnnggnnggnnnngttttttggnnngggttctnttggggg
gnaaaaanccttttttgtgtacttncggtaagcttcggctatcgacgggaccaccttatg
ttatttcatcatgGGGTGGACCTTGGTCTCGTGGTTTATGGGTGTCATTAAACGCGAAAT
AATTAGATTAAGGGCTTATTAAATTTATGCTAAATGGTTTCGCTTGGGTTGTTAACAAGT
TTTTATAACTGGCATTTTTTAGCAATTGTATAAAAGTATATACAATAATAATTATGTGTG
GGTATTTTCAACATATAAATGAACAGAAGAAAAAATTGGGTATAAATCAGATTTCAATTT
GTGTTTTTATTTGAAAAGCATAAAAGTAGATTATAAAAGCGTTATATTCGGATTAGAACC
CATAGAAGGTCCACCCTAGAGAGCACAGGTTAGTCGGAGGAGGCGAGTACAGTGGCAGCG
TTGTGGGGTCGTTTATTTGGGCTTTTGGAGCGTTGACTCGTCGTTGTCGGCTGTGCATGA
TGATGATGACGATGATGATGCAGAAGAGAATGATGATGATGATGACGACGACGACAACGA
TGGGAGAGGAGACGAGGCTGCTTGAATAGATGCTCAATCGTTTGGGGTTGAATGAAAGAA
AAGCATGTGGAGTGGCGAGTGGAAATGAAAGTGAAGTGNCCCATGGAGTNCCGGGTCCAT
GTCCGTATNCCGGGGTGGGGNGGCAAAANATTGGAGCCATGAATAGGGAATGNCCAAGAA
AGGAAACCAATGGAAGGAAGaaggaggaaggaaccagtagccnccaggnggggagngncc
actnggggggggcanaaaggttcctggntggaaggttgaaanaaatgggncatnaaaaac
ctggnaagcctggcctggncccanacnaaaaaccgagnaagccgggggggaaacctggca
anccggaaaaaaagcttcgnanacccag

Image Files
Larval GFP

g1 (->Large)

CLOSE