Detailed Information [113679]

Strain Information
DGRC Number 113679
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP5321 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP5321 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 87B14
Map Viewer
Related Genes CG31350 Hsp70Bb Hsp70Bc
Original Number 5321
Chromosome 3
Comments NP line. Received from the National Institute of Genetics.
Balancer TM6UW23-1
Cluster id 1465
General Information NP_lines
Embryonic Expression weak
Larval GFP sg
Larval X-gal not in discs. (s.g.)
Adult GFP mouse, internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np50035_0912
Strand Plus
Insertion Point 8335240
Chromosome Band 3R
Flanking Sequence
attttttgtntgcttaggaagcttcggctatcgacgggaccaccttatgttatttATCAT
GCAGTGTTTGACGCCAAGCGACTCATCGGCCGAAAATACGACgatcgaagaatacataag
agagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagcca
tccgacatgtcatcctnttcagaccaatcaaatccatgaagagcatccctgggcataaaa
tccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgt
ctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatgctgtctc
aatgttagaggcatatcagtctccactgaagccaatctatctgntncntcnttgnggtgt
gcaagngngccnagangggnagggcaggnngggaggggggggggggggagggggagggcg
gnngngggnnnngtgcanngnggngganngcgggnggggggggggnggagaggngcaggg
ggagggagagaagnnngaggggcgatntcntcnnnttntcntntntncngnnncnacgnn
ttcacnttnncntctgcncncctaccnnctatnccccncantcttttcnccccttnttcn
ntcncncannnncccntatntancncnnttnngtngcntaantcnctannngnngttgnt
tnagccncgntcncngtntncacncnnacangnggnnnttcncnnnncgnncgnttctgn
tcgnatttccctttgagngcgnnancgnncnttntncnntatcttcnncccnccatnnan
nntnnncctccgtngntncccccgctncgttnnnntttnccttnnccncgntttccngnt
ntttnnnntgtntcccccntcnntntcncntctgnttncnntcnanccctgtttgttntc
nntgnnncctncctncttactnttnttctnntncancgcntnattncatatnccng

Library Name / Clone Name np / np68113_0309
Strand Minus
Insertion Point 8335253
Chromosome Band 3R
Flanking Sequence
ggggcggccgcgttnngttttttgggnnnanntnagntngtcaanaaacnccannnttgg
gggagtggaagtacccttgccgtcgggnccaccttagttatttcatcatgAAACACTGTG
TTTCTGGGGTTCATGGCCACCTGGTTCTTGGCCGGTATCCNCNNGCNNGNGCTTAGGGCA
CTAGNNNATCATGGAAAAATANAACTAGAGCTATGANTTCGNNTAATTAATANNATGAGA
AAATNNAAATTNNTTTTTTTTNCTAAGGNTTANTAGTTGGNGGGGGGGGGNNNCNACATG
CNAANGNNNNNNNNNNNNNNNNNNNNNNNGGGGGGGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncn


CLOSE