Detailed Information [113696]
 

Strain Information
DGRC Number 113696
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP5362 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype w*; P{w+mW.hs=GawB}NP5362 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 66C13
Map Viewer
Related Genes CG6983 CG7015 BcDNA:LD13080
Original Number 5362
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP5362

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1826
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression very weak
Larval GFP weak
Larval X-gal N.C. no larva
Adult GFP weak
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np50395_0912
Strand Plus
Insertion Point 8400615
Chromosome Band 3L
Flanking Sequence
ganncgtgcactgaatttaagtgtatacttnggtaagcttcggctatcgacgggaccacc
ttatgttatttATCATGGGCGCAACCTACTACGCACACACACATGCNCGCACACGCAATT
GCAATCGTAAACTATTTTTACACATTATTGTTGTGGTTTTTAGCGTAAAATTAGCAACCC
CGCAGACTGCACACACACATGCACAGTCACCGAAGTGCCAAGTTGGTAGCAAAAAAACGA
ATTTTCATCAACTTTTTTTTCGGGCTGCAAATTTGGTACCCTCAAACGCACACACACACA
CACAGAAGCGTAGAAAATCTGGCTGGGCAACGAAAAAACGTTAATTCGCCATTTAAAAAC
TAATTTCCCTAACACATTTCATATTTTTCCATCACAGCTTTGTTCGCGGCACATTTTCTG
CATGTTTTCGTTCCGAATTTGAGTTAAATAATAGTCCTATTTGAAGCGAACGAGANTTTT
CTGGACCAGCCACACGTACCACACGACAGCACAACANCTGCTAGCGGGCGCNATATTTGC
CGACAGCACGATAGCAGTGTTGGAAGGTGTGCGAAAGTGAGGGACAATTGTGACGTCGGG
GGGTATGGGGAGTTGGAGCAGGGGATCCAAAAATTCNTGAGAGAGNACCGNNGNCNAAGA
ACCCATTTNTTGTTGGGGGTCCGGTTTCANGNAAGGGCAAGCCATTCCGACATGGTATTC
CTTTTTAAGACCCAATCAAAATNCATGGAAGAGCNTTCCCTNGGGCATTAAAATTCCAAC
GGGAATTGGGGGGNGTTNTTaatgatgaggctggcggagtcaaatcgatacagaacaact
gtttttgganccttnggtactactctnttncgaggaagatggcccacttattctttgctg
gccnaaggtagagnatan

CLOSE