Detailed Information [113698]
 

Strain Information
DGRC Number 113698
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}form3[NP5366] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}form3NP5366 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 65E4; -; 65E5
Map Viewer
Related Genes CG14824 CG8634
Original Number 5366
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP5366

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1799
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression mesoderm
Larval GFP sg
Larval X-gal not in discs. (s.g.)
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np50435_0912
Strand Minus
Insertion Point 7054354
Chromosome Band 3L
Flanking Sequence
ncactgaattaagtgtatacttcggtaagcttcggctatcgacgggaccaccttatgtta
tttcatcatgGACTGAAGTAACGGCGAGCTTGCGCGGCTTGATTTTCTACCGgatcgaag
aatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaa
gggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccct
gggcataaaatccaacggaattgnggagttatcatgatgagctgccgagtcaatcgatac
agtcaactgtctttgacctttgntactactctcttccgatgatgatgtcgcacttattct
atgctgnctcaatggtagaggcatatcagtctccactgagccatttntnnntggggnnng
ggnnnnnnnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnannnnnnaannnnnnnnnncnnnnnnnnnnnnnnanng
nntnntanngaagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE