Detailed Information [113705]

Strain Information
DGRC Number 113705
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP5375 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype w*; P{w+mW.hs=GawB}NP5375 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 77A3
Map Viewer
Related Genes CG13813 CG17149
Original Number 5375
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP5375

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1998
General Information NP_lines
Embryonic Expression weak
Larval GFP sg
Larval X-gal not in discs. (s.g.)
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]

Library & Clone Information
Library Name / Clone Name np / np50515_0912
Strand Plus
Insertion Point 20149216
Chromosome Band 3L
Flanking Sequence
agnncatgcactgaatntaagtgtatacttnggtaagcttcggctatcgacgggaccacc
ttatgttatttcatcatgGTTCGCGGGTAATACTCAAAAAGCTTCGGCGGTGGGCATGGT
TTGGTTTGGTATGGTATGATGGTATGACAAAAAGTTAAGTTTGATTTTTGTTTTCCTGAA
TCGCATTCTTTTCTAACTACTTGTATAGNAGCTTGCATATACGAGTAAGTCCGCCGCGAG
TGTATGTTCGNATTAGCAATGGCCTTGAGCCGGGTCATCGACCGAAGCTACTGACGTTAG
AGCTGAAAATAGAGCACAATAAGAAGTGCACTATCGTTCCTATCGATNGGCCTAAATATT
TTGTGCAAACCCTTCTGGATTTGGGCAATGTTGCTGCTTTACAAACAAAACAAATAGATT
AATCATGGGGTAAATATTAGTATTGCAGCGAAACCGAAAAACCTAGTTTCAAAGCTAAAT
AATTGAAGCTCTTTAGTTTGAATGGATCTTANNTACTGGNGCAACTAGTAAAATCTGCAA
ACATTTTAGNTTTGATTTGAATTAAACTACCAAAAACGTTNGGGGAAAACAGNACAAAAA
ANTNCCTTCTAANGTCCGNTGCTCTTTATCGGCTACCTAAATTGACCAATTGGNGGAAAN
GGCCTTAANTGAACTAAAANAAATTANTTTTTNANNCCTTTGAATTTTTAAAAAANANTG
GCCTTAGGGGTGGAAAAACAAAAAAAAAAACCCCTNCCNAAAAACCCCTTTTTGTTGGGG
NCCCNTTTNGGAGGGGNNGNccanccgnntgnaaanntttttnancaannaaancntnna
naccatccntggnnaaaaaacaccccnttnnggggntntnataanagccn


CLOSE