Detailed Information [113738]
 

Strain Information
DGRC Number 113738
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP5446 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP5446 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 80C3
Map Viewer
Related Genes nrm 297{}1107
Original Number 5446
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP5446

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 2044
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression amx, lateral dot, oenocyte?+other cells, PNS (ch subset, TU)
Larval GFP all muscle
Larval X-gal ch organ. (s.g.)
Adult GFP all (?) PNS.
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np47415_0912
Flanking Sequence
GNNNNNNGNNNNGNGNNGGGNGGGGGNNNGGNNNNAGGGGGNNGGGGGGGGGTTNNNGNT
TCCTTGGGNNNGGGNNACANAGGNGGGGTNAAAAAAGCCCCCNNTCTTTGGGGNNACNNN
NCGGAAAAGCCNNCGGCTATCGACGGGNACCACCTTTNGNNATNNCATCANGAGGCAGGG
GGGGCGCNNAGCNCANNNGNCNCTNTGCNGGGGGCNGACGACNNGCCGCCTNCAAGNNNG
NNNCAGNNNCAANNNGACCGNCGAANGCAGAGAACGNCGGNACACCGCTCTNGCTATNGC
TATCGGCCAGCTAAAACAAAAACGACCNGAAGCGGGGNAAACGCGNGNGAANGAGAGGCC
AACGAAANANCCATAGCATAAGNGAACAGNGAGCCAGNGAGCGCTNNAAANAGAAAACGC
GAAANAGNCAACNCGANGGAACGCAAGNGNAGGAAANAAANCGCCGNCTAGANNATNATA
GCAAAANNGCCAAAANAACCACTNGNGAGCCAAAGNGACACAANGNGAAGAGCAAACGAA
AANATAAAAANAAANNAAAAAACAAANAAANAAANGCAANAGGGNNAACNNAAACANCAC
AGGGGAAGGANNANCAAAGGCCCNGANCGAAGAANACANAAGAGAGAACCGNCGCCAAAG
AACCCANNANNGNNGGGGNCCGNNNNCAGGAAGGGCAAGCCANCCGACAAGNCANCCNCN
NCAGACCAANCAAANCCANGAAGAGCANCCCNGGGCANAAAAACCAACGGGAANNGGGGA
GNNANCANGAAGAGCNGCCGagncaancgaaacagncaacnggcnnngacccnnnggnac
cacncncnnccgangaagaagncgcactnanncnangcnggcncaagggnagaggcanan
cagnccccncaannnnnnnnnnnngnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnan

Library Name / Clone Name np / np66863_0309
Strand Minus
Insertion Point 22915585
Chromosome Band 3L
Flanking Sequence
ggnnnnggnngnggggagnnggncgggggcgaggggngtnaggttttttgggngggacna
annggggcnnaaaacccagnnttcgggannggnagacccctgccgacgggnaccacctta
cgttatttcatcatgAACTGACTACGACGTAGGGAAACAACCCCTAAATTGGCGTCGGCT
TCCTTGCAGCTGCTGGTGTTTTAAACAAGTGTTNGGGACAAATGCGTCAGCCGCATGCTA
GCCGNTTTTGACAGACGTCTTCACGGCTGNGAATTCGACGCTAATTATGAAGNTGCCAAT
TCCCACGACNGGACAGNAGTATATATGTATGTATTAAGTTAAGATTACTATGTGAATNGC
GTGAGGNGAGTGAGACTAAAAAGCATTNNCTATTGGAGTNCGNATGTNNNTATAGAAGAT
CCNCNAGCNAGAGCANAGGCCACNAGNGGANCNGGANCCNNNANCNAGAGCNNNGNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnncccnc

CLOSE