Detailed Information [113751]
 

Strain Information
DGRC Number 113751
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP5475 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP5475 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Original Number 5475
Chromosome 3
Comments NP line. Received from the National Institute of Genetics.
Balancer TM6UW23-1
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression weak
Larval GFP sg only
Larval X-gal not in discs. (s.g.)
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np47615_0912
Flanking Sequence
ngnnnngnnnggnggggnccgcccangggnnggaggggttnngnttncttggnnngaana
aacggggggtaaaaagcccnnntttnggganactncggtaagcttcggctatcgacgggn
accaccttatgttatttcatcatgGNACCGCGTAAAAGTTTCTTCCGTTTCGATCGAAGA
NGNCANAAGAGAGAACCGNCGCCAAAGAACCCATTATTGNTGGGGTCCGNTTTCAGGAAG
GGCAAGCCATCCGACATGTCATCCTCTTCAGACCAATCAAATCCANGAAGAGCATCCCTG
GGCNGGGGNGCCAACGGAATTGNGGAGTTATCATGATGAGCTGCCGAGTCAANCGANACA
GNCAACTGGCTTTGACCTTTGGTACTACNCTCTTCCGAAGANGANGNCGCACTTATTCTA
TGCTGGCTCAANGGTAGAGGCATATCAGNCTCCACTGAAGCCANCCNAAANCNGGNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNnncccccccnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnn

Library Name / Clone Name np / np67043_0309
Flanking Sequence
nntcttctgcgcacttattgcaagtntncgttaagtggatgtctcttgccgacgggacca
ccttatgttatttcatcatgCGCGGTACGATACGAACGATCCTCTAGCTGGAGCTTTGNG
TACTCGNAAATTATTAAAAATAAAACTTTAAAAATAATTTCGTCTAATTAATATTATGAG
TTAATTCAAACCCCACGGACATGCTAAGGGTTAANAANCANTGATNTTNNTNCCNGACTG
NTACNNANGNGGGGGNTGNAAACACNCTTTNTTTNNNTNGNACTTATTGAAAGNAAANGN
NTNAAAGGATNTCTNTNGNNNTNANANNCNNAGTTNNTTANNACNTCATGNNCGTGCNAA
GGCGAANNATNCNNTNNNTNNAGNNTNGNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNA
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnn

CLOSE