Detailed Information [113771]

Strain Information
DGRC Number 113771
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP5628
Genotype w*; P{w+mW.hs=GawB}NP5628
Break points/Insertion Site 4C5; 85B2
Map Viewer
Related Genes CG12685 bi CG8369 CG9821
Original Number 5628
Chromosome 4
Comments FlyBase Insertion: P{GawB}NP5628

NP line. Received from the National Institute of Genetics.

Cluster id 129 1391
General Information NP_lines
Embryonic Expression brain, PNS(ch, TU) , CNS(2-4 cells/hemiseg)
Larval GFP PNS. dbd, lbd in thorax, vbd in abd.
Larval X-gal dorsal and ventral ends of the eye disc. (s.g.)
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np38585_0907
Flanking Sequence
GGTTTTTTTGGGNGNGGAANCCCCNGTGGGAAATTTNCCACCCTCCNTTGGGGGGNNNNN
AAAAAAACCCCCAANGCGACGGGNACCACCAAATNTTTTNGGCCTCCTGCTNCGGGGGNT
GGCGCTNGGCNCTCCGNNNGAGGACNGGGGGGGCNTCCCGCANCNGCCATGCNNGCTNGC
CCGCNACNNGGCNGCTNCTCNNGACCNNNGNACCCCGNCGCNCCGCCCCNGCCCCCTGNN
CCCCGTCCCGNTTTCCGCCAGCGCCCCCCCGGNCCCNGGGCGGGGNNTGCGCCCNANCCC
CCNGGTGNGGTCCGNCCCGGCNTGCGTTGCGGNGCCCGNGGGNCGCCGCCCTCNNCGNGC
GNCCCGCCNCNCTNCCNCCGCCCCCGGGGGGANGGCCCNTTNNCCCCCCTGGTCNACGNN
CNGACGCCCGGNCCNCCGNCCGCCCCCCNCCCNACCNGTNTCCCNCCGNGNNCNGTNTNC
NCCCNCGCGCCCCCNCCGNCCGCCGCCGCCTTGTTCNNCCCCCCCGGCCNCNCCCCCNGG
CNTGNCCCCGTCCCGCNNCCCGCCCCCGCNCNNCCNGCCCTCNCGCGGGNGCCGCGCNCN
CGCCNCNCGCNCGCGACCCNCCCGCCCGNGCCCGCACCTCNCGCTCGCGTNGTCCCCCCC
CTTACCGGTCCGCCCCCCCCCCCCCNCNNCCCGACNCCCCAACACAAAAAAGGGTTTCGC
TCGTTGGNAAACNGCCCCCACCCGCNCCTGCNNCCGCTCCCGCCGGCCCCNCCCCCCCCN
TNTNCCCNGGGNGGCTGGGGccaacgncccaagttcgcccccgcgcggcaccccgnaacg
tgcggggaganntnagagngncggnnnnccccncgnacaancgagggngccntcncagta
taaanngccccccccccgccccccccgtaccacaccctncgcgccnaaccacaacgcacc
taatnannnnaccncaaaaaanngggtncgttncgnacaacacacanacactgngaccgc
ccatngacantnaccgncgcngtgatngngcgtccncacatcnaccccncatgtaaacca
gncacnataaaccccatccannactcctaacaaaaaaaaganccaacaaacccccgnncc
ganagttctncgcacaccccnccgccannatcacacaccccgnttanttgactnattgcc
cccacacantataacnttcnaacaaaggagaaaaaanaacannnnnnnnanaag

Library Name / Clone Name np / np64383_0309
Strand Minus
Insertion Point 4248029
Chromosome Band X
Flanking Sequence
tttttttgcntnctcnttcntgcagtcatgacgttangtggatgtctcttgccgacgggc
accaccttatgttatttcatcatgCCCCAAATAAAGTCGCTGAAGACGAAGCCTGTTTTC
TTGCTTTTTTTTGCCACCACAGCGAAAGAAACCGGAGGTGTTGTCACCGTCCCATAGATG
GCGCCCGTTCGTTGCCGGCGTTAGCGGACAGATGGCGGTAGTGTGCGCGAACACGGAAGG
TTTTGAATGCCACGGCTATTCCATATATCCAATGAAGATACCTTAAGATACATTGCTTTT
ACAAATGTTACGAGAAAATCATTCGTAACTATTGAGCAATTTNCGAGTAATACAAAAAAG
CAGGAAATATAGNTATTTCANCCTTGTGAGNCCTGAAAAAGGTTAAAATACTGGATCCCC
TCNNTNACGCTTTGGTCGCNNCNNNNTTCNTATNCCNCTNNNANNNAGNTNTTTTNNCCN
CNTTTNCNTTCCCNNNTTNNTGGGANAANTNANTGTACCCGNNNGANANNCTNTNAGTTT
NNNNANNTAANTTNATATNATGGNANAATCGNNCATNNNCNTCNTNCTCNNNTTNNCNAN
NCCAGTNTNATCCNCGNTANNNTNNNNATTTTCNCCCCCCANTTATTATTNTNNNCTNCG
NAACAANNTCCCNNANNCAAACCTTTTNTTATNTNCCCNNNANACNGCNCNCNTNNCCCN
NCNNANNACCCNTNCCGTNTNNTTNTATTCNTNCNTNACCTNNNTCCCCCNCCCNCNCTC
NNAAATNCNNACCNNNNTCAanccgcnncccnttcnttnnnttatanncgttccccccnc
ccnccncnnttttnntctttantccnannaatcaatantncnccntncgcctnnnnatnt
nncnttnnnacannnntnccccccctcnttgnantnttcccannnancnnctnnt

Library Name / Clone Name np / np70755_0810
Strand Minus
Insertion Point 4646437
Chromosome Band 3R
Flanking Sequence
caacgtgcactgnanttantgtatacttncggtagncttcggctatcgacgggnaccacc
ttatgttatttcatcatgGTCCGCGCAGTCGTGCGCTTGTGTGAGTCATGGTGGAAAATT
CGAGGCAAGCGTACCGATGCGCAAAGAACAAGCATAAGCGAAGAAGATAAAGATATCGAT
TAAAATTTCTGCTACAAAAATAAATATATATGTAACGCATATTGTAAATGTTCTAAGTTA
AGTGACATAAATCAAATATTTGTGTAAAGTTTAATATTTTAATACGCGTCGAAGTACAAC
GAGTGAGGCTACAGAAGAGCACACACTAAAGTGGAGTACTTGGCGAGCGCAAATAACGGA
AATCAAATTCGAAATAAACGCTGCGCAATAGACGGTGGTGTACATAAGAGTTTAACAAAA
TCCGAATCAGAATCAGTTGAAAGTGTGATTTTTTTGAGCCTTTGTCTGTAAGTGAAGAGA
AAGCTTTAAGCGGAATTACATCTATATATATATATATAAATATATAAATACGAAGCCAGC
CCGTCGCCATTTTGAAAGTGATTTTACAAAACACACACACACACATATATATACACAGNT
GCGAACACATCCACATATAACCCCAAATAAAATCCGAAGAANAGAGCAAAAAAAAAACGC
NAAACAAACCANTTCCCGCAACNTTTTAAAGGGGAACATNCAAATAAGGGCNNNNTTTTT
ACCCCAAACCCCACCCCTTTTTGTNTTAACCCTTGGGNGAAATTNNAAAATNTGTTAAAG
AAGGGGGGGGAAAAACTGGGanacacccncccccgcnagcccctttttnggngggggggt
cccgggaaaaaaanaagncccaanggggtnaaaaacncggggggggggtgggngc

Image Files
Disc

d1 (->Large)


CLOSE