Detailed Information [113787]
 

Strain Information
DGRC Number 113787
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP5922 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP5922 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Original Number 5922
Chromosome 3
Comments NP line. Received from the National Institute of Genetics.
Balancer TM6UW23-1
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression No expression.
Larval GFP gut, mt
Larval X-gal checked
Adult GFP Dll-like! ant, lab. prob. tarsas.
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np47835_0912
Flanking Sequence
tcaacgtgcactgaatttaAGTGtatacttcggtaagcttcggctatcgacgggaccacc
ttatgttatttcatcatgagtggatcgaagaatacataagagagaaccgtcgccaaagaa
cccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcctcttc
agaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgtggagtt
atcatgatgagctgccgagtcaatcgatacagtcaactgtctttgacctttgttactact
ctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcatatcagt
ctccactgaagccatcttattntgggnnnnnnntnnnnnnnnnncnnnnnnnnnnnncnn
nnnnnnnnnngnnnncaangntnnnnntnnnnngnnnnnannccntnnncaaannnnnnn
nnnnnngnnnnnnnnnngnnnnnnnnnnnnnnnnnnnngnnncnnnnnnnntanncnngn
nnnnnnntnnngnnnnnnnnncnctnnnnnnnnnnnnnccnnnnnnnnnnnnnnngannn
nnnncnntnnnnnnnnnnnnnnnnacnctnnnnncnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np67143_0309
Flanking Sequence
atatcttngngcgcacttatncgcaagttttacgttaagtggatgtctcttgccgacggg
naccaccttatgttatttcatcatgGATCCTCTNGCTAGAGCTTNGGGNACTCGCAAATT
ATTAAAAATAAAACTTGANAAATAATTTCGTCTAATTAATATTATGAGTTAATTCAAACC
CCACGGACATGCTAAGGGTTAAGNGACAATCANAACNCNGNGNNNNTGNTATNNGANAAN
AAACNANTNATNTCTGGNGGGNGACACTCCNCACTNAANGGCTGCGTACGTNAAGTGGAT
GTCNCTTGCCGACGGNACCACCTTATGTTATTTGATCATGGATCCNCGACCGGGCNACTT
GANGACTNGNNANNNTGGANNCTNNAACTNGAGCNNTGNNNNCNNNNAAATNATNNNANN
NGNNANNNNANNNNNNNNNNNNNNNNNNANNNNNANNNNNNANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE