Detailed Information [113893]

Strain Information
DGRC Number 113893
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}KCNQ[NP6285] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}KCNQNP6285 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 46F3
Map Viewer
Related Genes CG12214 KCNQ roo{}796
Original Number 6285
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP6285

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 651
General Information NP_lines
Lethality lethal
Embryonic Expression pairs of cells in CNS midline.
Larval GFP fb, gut, epi, DT fusion cells (091098)
Larval X-gal sg, trachea,
Adult GFP ubiquitous
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np38665_0907
Strand Plus
Insertion Point 5219255
Chromosome Band 2R
Flanking Sequence
ctttttnggggcanaaacccctttttgtacttcggtaagctncggctatcgacgggacca
ccttatgttatttcatcatgAGTCAGTCAGTGGCTATATGTGTCTGCGAGTGTGTGTGTA
TGGGTGAGTCGTGCGCTCGTGTTCGAATTCGGATTCTGGCCTGTTTAGTGCTTTTTGTGT
GTAGGTCGCTCGACATGCGCACAGGGGCGGTTCGGNNCTGAACAGGGAGATTCTTGGGTA
TTCCGGACGAAAAAAGAAAATTTGTAGTACCACAGATGCGATAAGTTCTCGNCTGATGTG
CGTCCGAATACCGNTTCTTACAAGAACTTACCGGTTAACTTTNNTNGCCTNCCCGNAACN
AAAAAAAAAAAAAAACCCCGNGGGGGGGNTTNTTTTTNCCCCNTCCCCTTTTTNNCTTGG
GGTTNGGNANCCCCCCCNTCNCGCNAAANTNTTTNAAANGGGNGTTTTTTGTGGANAAAN
TTTTNGTTNTTNTNAACNCCCCCTTTNNNGGNGTGGNGNGGNCGCNNAAAAAAAANANCN
CNCCACAANCCCCCCNCGGAAAANANCGGTTANNCCCCCCCNTNNAAAANCNTTTGNGNN
TTTTCNANACGCNCNCTTTNTAAAAAAANTTNTNTATTTCNNTTNNTACNCCANANNNTC
CCCCAAAAAAAAAACCCCCCCCTNTTTTTTNCCCCCCCCCNNTTCAAAAAAAAAAAAAAA
TTTTTTTTTNTNATCNCCAANAAANNCNTTNATTAANTNNTCCNCCAAAANNGNGTCTNT
AAAAAAAAAAANAGGGGGNGgcccccnnananntggggngcccgccntttttttcccccc
ccccccttttntgnnaattantgtnaccaaaaanctttttcccccnnaaaaaaaaaaaan
cnccnttttttctttncncaaantttttttccnaaacnantnccncccgnccaancanan
nctntttggccnntncccncnnttnnttttntccnnggngngttttcccccntnccnccn
ntttaacaaaaattttttttngggggtgtcnncnacaanaat

Library Name / Clone Name np / np69365_0810
Strand Plus
Insertion Point 5219254
Chromosome Band 2R
Flanking Sequence
atttttcaacgtgcactgnanttantgtatacttncggtagcttcggctatcgacgggna
ccaccttatgttatttcatcatgNAGTCAGTCAGTGGCTATATGTGTCTGCGAGTGTGTG
TGTATGGGTGAGTCGTGCGCTCGTGTTCGAATTCGGATTCTGGCCTGTTTAGTGCTTTTT
GTGTGTAGGTCGCTCGACATGCGCACAGGGGCGGTTCGGGCCTGAACAGGGAGATTCTTG
GGTATTCCGGACGAAAAAAGAAAATTTGTAGTACCACAGATGCGATAAGTTCTCGTCTGA
TGTGCGTCCGAATACCgatcgaagaatacataagagagaaccgtcgccaaagaacccatt
attgttggggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagacca
atcaaatccatgaagagcatccctgggcataaaatccaacggaattgtggagttatcatg
atgagctgccgagtcaatcgatacagtcaactgtctttgacctttgttactactctcttc
cgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctcact
nnntcnnnnnnnnnnnnngggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE