Detailed Information [113910]

Strain Information
DGRC Number 113910
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}Pen[NP6315] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}PenNP6315 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 31A1; -; 31A2
Map Viewer
Related Genes CG4791 Pen CG4804
Original Number 6315
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP6315

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1145
General Information NP_lines
Embryonic Expression muscle
Larval GFP sg
Larval X-gal scattered cells,
Adult GFP ubiquitous
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np48125_0912
Flanking Sequence
GNGNNNNNNNNNNNNGGNGNGNNNNNNNGGGGGNGGAGNANGAAAAANGTNTTTTNGNNN
GGGNTGCCTNGGGGNCACTGAAANNAGTGGGAGACTNCGGNAAGCTNCGGCTATCGACGG
GACCACCTTATGTNATNNCATCATGNCGNAAGCGAGGCGAAANNGGAGNCAANGCCTGCT
NGGCGCCGCCAGAATNNACCGNNNGATNNGAAAAGCAAGCCTNAGNGGCGAACGAAACGC
AGANGGCTATCGANCGAAGAANACATAAGAGAGAACCGNCGCCAAAGAACCCANNANNGN
NGGGGGNCCGNNNNCAGGAAGGGGCAAGCCATCCGACANGNCANCCCTCTNCAGACCAAN
CAAAANCCANGAAAGAGCANCCCCTGGGGCATAAAAACCAACGGGAAANNGGGGGAGNNA
NCANGANGAGCNGCCCGAGNCAAANCGANACAGNCAACNGGNCCNNGACCCNNGGGNACN
ACCNCCCCTCCGAGAGGACGGCCGCACTNAANCNANGCCGGCCCAAANGGNAGAGGCANA
NCAGNCCNCCACTGAAAGCCAATCCAACCGGNNNNNCCCNNNCCCNCCNNNCNNNNNNCN
CCNNCCCNCNNCCNNNNNNNNNNNNCCNCCCCNNNNNNCNNCNCCNNNNNCCCNNNNNNN
NNNNNCCNNNNCNCNNNCNNCCCNCCCCNCCCCCCNNNNNNNNNNCNCCNCNNNNNNNNC
NCNNNNCCNNNCCCCCNNNCCCCGNCCGCNNNGNCCNNNNNCCCNNNCCNNCCCCCCNNN
NNCNNGNNNNNCNNCNCNCNnnccccnnnnnccnnnnnnncnnnnccnnnnnccnnnncg
ccccccccncccgccnnccnnnnnnnnccnannnnnnncgnnnnnnncccccccngccnn
cncccnncccncnnnncnncncnnnncccnncccnnnnncnnnnnnnnnnnnnnnnncgn
ngnanncccncncnccncncnnnnnncccncccncnnccccnnnnnnaccnacacaaaaa
nac

Library Name / Clone Name np / np67293_0309
Strand Plus
Insertion Point 10049430
Chromosome Band 2L
Flanking Sequence
ntntttctgcgcacttatccncaagtctttncgttaagtggatgtctcttgccgacggga
ccaccttatgttatttcatcatgGATTACGAGAGTACTGTCTACGTTTGTCTACAGTTTC
ACCGACACATTCAGCGTGCTAACACGCTCGACAAATTCTCGTGCTCGCGTTTCGTTAGGG
AACGATAAAAATTGTGTAAAAATTCAGTAAAGTGAATTTCCATCCGAAAAAGCCAGCACA
CGCATTCAAAAGGGCAAAGGTACAAAGGTAAGTGCGTGTGTACTCTTTTCTTCCTTTTCG
CGGTTTTTCCCACTGCTTTTTACTAGCGTTCATCAATTTGACCGCCTCTTCGTGATCCTC
TAGCTAGAGGCTTTGGGTACTCGCAAATTATTAAAAATANAACTTTAGAAAATNATTTCG
TCTAATTAATATATATGANTGAGTTNATAACNACCCGGACATGCTGCTGNGGGTTAATNA
ACAATNATNTNGNTGNNTNACTNANNNNNNNNNNNCNNNNNNNNNNACNNNTNNNNNNNN
TNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnn


CLOSE