Detailed Information [113920]

Strain Information
DGRC Number 113920
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}Pen[NP6333] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}PenNP6333 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 31A1; -; 31A2
Map Viewer
Related Genes CG4791 Pen CG4804
Original Number 6333
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP6333

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1145
General Information NP_lines
Embryonic Expression CNS, sg (TU). weak
Larval GFP wing, hal, genital, tr pit, tr hb.
Larval X-gal ubiquitous in discs, CNS, gut,
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Tang HY, Smith-Caldas MS, Driscoll MV, Salhadar S, Shingleton AW.
FOXO regulates organ-specific phenotypic plasticity in Drosophila.
PLoS Genet. (2011) 7(11) e1002373 [PubMed ID = 22102829] [RRC reference]

Stieper BC, Kupershtok M, Driscoll MV, Shingleton AW.
Imaginal discs regulate developmental timing in Drosophila melanogaster.
Dev. Biol. (2008) 321(1) 18-26 [PubMed ID = 18632097] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np48255_0912
Strand Minus
Insertion Point 10049462
Chromosome Band 2L
Flanking Sequence
cgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccaccttat
gttatttcatcatgCTGTAGACAAACGTAGACAGTACTCTCGTAATCGATGCGAAATTGG
AGTCAATGCCTGCTTGGCGCCGCCAGAATTTACCGTTTGATTTGAAAAGCAAGCCTTAGT
GGCGAACGAAACGCAGATGGCTATCgatcgaagaatacataagagagaaccgtcgccaaa
gaacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcctc
ttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgtgga
gttatcatgatgagctgccgagtcaatcgatacaggcaactggctttgaccnttggtact
actctnttccgangaagaaggcccncttnttttttgccggctcaanggtaangggantta
annnccncnaacccnnnnntnnngnggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)

d2 (->Large)

d3 (->Large)

d4 (->Large)
Larval GFP

g1 (->Large)

g2 (->Large)

g3 (->Large)

g4 (->Large)


CLOSE