Strain Information | |
---|---|
DGRC Number | 113920 |
Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}Pen[NP6333] / CyO, P{w[-]=UAS-lacZ.UW14}UW14 |
Genotype | y* w*; P{w+mW.hs=GawB}PenNP6333 / CyO, P{w-=UAS-lacZ.UW14}UW14 |
Break points/Insertion Site | 31A1; -; 31A2 |
Map Viewer | |
Related Genes | CG4791 Pen CG4804 |
Original Number | 6333 |
Chromosome | 2 |
Comments | FlyBase Insertion: P{GawB}NP6333 NP line. Received from the National Institute of Genetics. |
Balancer | CyUW14 |
Cluster id | 1145 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | CNS, sg (TU). weak |
Larval GFP | wing, hal, genital, tr pit, tr hb. |
Larval X-gal | ubiquitous in discs, CNS, gut, |
Adult GFP | internal |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Tang HY, Smith-Caldas MS, Driscoll MV, Salhadar S, Shingleton AW. FOXO regulates organ-specific phenotypic plasticity in Drosophila. PLoS Genet (2011) 7(11) e1002373 [PubMed ID = 22102829] [RRC reference] Stieper BC, Kupershtok M, Driscoll MV, Shingleton AW. Imaginal discs regulate developmental timing in Drosophila melanogaster. Dev Biol (2008) 321(1) 18-26 [PubMed ID = 18632097] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np48255_0912 |
Strand | Minus |
Insertion Point | 10049462 |
Chromosome Band | 2L |
Flanking Sequence | cgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccaccttat gttatttcatcatgCTGTAGACAAACGTAGACAGTACTCTCGTAATCGATGCGAAATTGG AGTCAATGCCTGCTTGGCGCCGCCAGAATTTACCGTTTGATTTGAAAAGCAAGCCTTAGT GGCGAACGAAACGCAGATGGCTATCgatcgaagaatacataagagagaaccgtcgccaaa gaacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcctc ttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgtgga gttatcatgatgagctgccgagtcaatcgatacaggcaactggctttgaccnttggtact actctnttccgangaagaaggcccncttnttttttgccggctcaanggtaangggantta annnccncnaacccnnnnntnnngnggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |