Detailed Information [113937]

Strain Information
DGRC Number 113937
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP6372 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP6372 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 38E8; -; 38E9
Map Viewer
Related Genes CG9326 CG9328
Original Number 6372
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP6372

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1272
General Information NP_lines
Embryonic Expression weak muscle
Larval GFP weak epi, cns.
Larval X-gal sg, CNS, mt
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np48535_0912
Strand Plus
Insertion Point 20767103
Chromosome Band 2L
Flanking Sequence
ACCCTTGGGGGGNAANAAACCCCCCTTTTTTGGGNGNNCGGTAAGACTCCGGCTATCGAC
GGGACCACCTTNTTTTANGGTCATCATGGTTCGTTCATATGACAATTAGAAATCAATTTA
ATTAAATAGTCTTTAAATTGCTTATGGAACTTTATTTATGCCTTAACAAAACTCTGGGAT
GCAACAAACTTCGTTACTTCAATAAATATGCAATATTTTATTTCTNTTTTTNGAAAGGGT
AATAGACGTNGACTGGCCATAGATGAAAAAACATCGGTTCTCGCTTGCGGTATTNTTCGA
AGCTTCAGCATGCCTCGGCATTNTTCGGCTGAAACGAAGCGACAGCNCNNGGTTTCATTC
CCGNTNNGAGCAACGNGGCGCCNNCGGGGNCTTCCNCCGCCATGGAGNGGAAAAACCAAT
NAAACACCACCNGGGGGAANNACATCCNCAGCGGAACNAGGTTACCGCCNGAAAACCGAT
TNGNGCNNCGCCNAGGNANANCGANANAGCCTTTNGGGGCNTCAAAAAAAAACCCCNAAN
TTNNGGGGGATGGCCCTCNNCAANGGGAAAACCCCCCGGGGTCCCCCCCCCCCANCCNTC
CGTTTCCCGNAANCCNATNGGNCNGGGGGGGAAAAAACCCNTNGGGANNCCNNCCGCNAA
ANNNCCCNCCCAAAAAACNNNGGCCCGGNAAAAAACCGCGGANTGGGNNNNAACCCCCNG
GGNNAANAAAANCCCCGCGGGGAAAAAANAAANCCCCCGGGCNGCCCCCNCCCCGGGANC
GGGGTCCGGNCGGNTNTNCCcangtcncccaaanggggnggggcccgnnntnntcccgcc
ccggnnggnggggngnnnaaaancaaaaanaggcaccncaaancncngcgnncaaaaaac
cccncgaaangngccaancgggnaaaaanangncnaaaangggggncaccncccaaanng
nngngaggnccanntttaaaccngnaanacccggnngncncncacanaanaagaantngg
ggancaaaaaannggggntctngcggtcgcngaaaaag


CLOSE