Detailed Information [113950]

Strain Information
DGRC Number 113950
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP6399 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP6399 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 57D13
Map Viewer
Related Genes CG10795 cv-2
Original Number 6399
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP6399

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 900
General Information NP_lines
Embryonic Expression weak CNS, PNS(ch, TU).
Larval GFP sg, gut
Larval X-gal sg, CNS, mt, midgut
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np41485_0907
Strand Plus
Insertion Point 16423061
Chromosome Band 2R
Flanking Sequence
aatntttagngtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacggga
ccaccttatgttatttcatcatgCTNTGGNCCAAANTATTGCANAAACACTCCCACGNTG
CAACAGATNCNANACTACATAACAGAGAACNNTNGGCNACTANCCCATTGNTGGNTGNGG
NTCNTGTTGCAGGAAGGGCACGCCATNNGANNTGTCCTGNTNTTGAGACCAANCNANTCC
ATGAANAGCTTNNNTGGGNATAAANTNCAACGCNATTGTGGAGTNNTNANGANNAGCTGC
CGAGNCAATCNNTACANACAACTGNNTTGGACCTTAGANACTACGTGTCTNNCGATGATG
ATGANNNACTGATTATANGCTGANNGANTGCAGGAGGCGTATAATAGNTNCACTGANGNC
ATCCCNTTNTTTGGGGGAGGGNNAAGGATATNTNATATCCACCTGTACCCAGTATTGCNG
GGCTGCCGACTTTCANAGGCGCACTCTNCACGAATTGCAATGGAANATNGAATATCAATC
TACATTCACACATTCTNTAAGCGAAACGAACACCCTCGACGATGGCTAAGTGTTAACAGG
GCGAACATGAGANGCGACCCCCCCCCCCTANNGCAATGGGGNGGGAAAAAAACNNCCNGT
TACAANTTNAANGCGGNCAGTNAGGNATTANANNCCGGGNACCTTTGAANCTATAAATTT
TGNAGAAGGNNTTCCNGNCGGTGAAGCCTNAAATTATTNTTTTNNAATNCANCGGGGAAA
TTTTCCCGAGGNAAAANGGTtttttgggncccggnntnanggnggtngnttcccccccnc
ccnnncnntttnnaannnaaagcctggngatnngnccnnannnnnaaan


CLOSE