Detailed Information [113973]
 

Strain Information
DGRC Number 113973
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP6545 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP6545 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Original Number 6545
Chromosome 3
Comments NP line. Received from the National Institute of Genetics.
Balancer TM6UW23-1
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression very weak
Larval GFP all epi, tr
Larval X-gal sg, weak epi,
Adult GFP tarsas, ant. internal thorax, head.
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np46415_0912
Flanking Sequence
gtgntcttcggtagcttcggcttcgacgggaccaccttatgttatttATNATGGTCGgat
cgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttc
aggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagca
tccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatc
gatacagtcaactgtctttgacctttgttactactctcttccgatgatgatgtcgcactt
attctatgctgtctcaatgttagaggcatatcagtctccactgaagcatntttntnttgg
gggnnngnnnttntnntttnannttnnnntngnncaatnatncnggnnacaangcntntn
ntntnccgnnaagaannccnttntnaaaattntgtnnngggnctnntnnnnggaaaantn
nnnnnnaanngntgntnccnnnctttcnaanccttgttnccntttnngnnnnannnnccc
tannnnnnggnacctttnggtttngggannnnnnnnncnctnccnnnnngnnntnanacn
cttggnncncntnngnnntnnnttnngnnccctnnnnnttttnnannnnnnnnnntnnnn
tnccttnnnnnnnnnanannnnnntnnnnttnnnnnnnnnnnnntnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnn
nnannnnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnn
nnnnnnnnnnnnnnnnnnncnncnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnn
cnncnnnnn

Library Name / Clone Name np / np66523_0309
Flanking Sequence
atnnctattgcgcacttattccaagttatatgttaagtggatgtctcttgccgacgggna
ccaccttatgttatttcatcatgGATCCTCTAGCTAGAGCTTTGNGTACTCGCAAATTAT
TAAAAATAAAACTTNAAAAATAATTTCGTCTAATTAATATTATGAGTTAATTCAAACCCC
ACGGACATGCTAANGGNTAANCAACAATNAAAACGNCGNTTTAATTTTTTTTTTANGANA
CCNAAANNTTNNGGGGNNCANNNCCACNTAATGNNAGNNNACCNNNAATNGATGNNNNNN
GGCGNCGGGNNCACCCTAAGGTAATNNAATAAGGNTTCNCTATCCNNAANTTNNCNNCCN
NCNAATTNNGAANNNNNAAANNNAAANNTTNNTNNCNNNAANTNAANNNANANNNNNNNA
NNCACCNNNNNCNTNNNNNANNCNNNNTGAACNANNNNNCNNNNNNTNCANNATNTNANT
CNNGNTTTNANNTTTNNTNNNNNNANNNANNNNTTNTNNCCNNNNNANNNNNNNNNNNNA
NNNTTNNNANNNTNNNNNNACCNNNAANAAAACNNAAACNTTCACNNNACNNNNNNNNNT
NNACCNNNGNNTNTNNNCNTTNNNNACCNNNCNNNNNTTCNCNTTTTTNNNNNNCNTCNT
TTTNTTNNTTTNNNNNNTTCTNNNCCCNTTNCNTNNATTTNNNCCNTNTTNNNNNGTNNN
NTANACNTTTAANNGGNNNTNCNNCTTNNNCTNNNNNANNNAANAANACNNNNNTNTNTN
NNNGTNNNNNNTTNNTTAATttnnccncccccnnatttnnntnncnntncccnccnttgt
tnnnnntnccccccntatannnacatttcttnnnctttnnannnncntncccgnntnnnn
ccntnncnnccntnntactttnnnccgcnatannnntnanacnntnannnncncccgngc
ccnncn

CLOSE