Detailed Information [113994]

Strain Information
DGRC Number 113994
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP6592 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP6592 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 87B13; 87B14
Map Viewer
Related Genes DM88{}1333 invader1{}1334 DM88{}1335 DM88{}1344 invader1{}1345 DM88{}1346
Original Number 6592
Chromosome 3
Comments NP line. Received from the National Institute of Genetics.
Balancer TM6UW23-1
Cluster id 1462 1463
General Information NP_lines
Embryonic Expression a small # of cells
Larval GFP sg
Larval X-gal ch organ, sg, weak epi
Adult GFP flight muscle subset.
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np38805_0907
Strand Minus
Insertion Point 8315143
Chromosome Band 3R
Flanking Sequence
ntttttaggggnaaaaaacccnttttttgngctnnggtaagctncggctatcgacgggac
caccttatgttatttcatcatgGTCTGTACGAAAGCGAGAAGCATACAGAAAAATGCGGT
GTGCATAAGTAATGGTGTATGCGGACTAGAACAACTGTCATAATTGTGTTGGTATTGCAT
GTAAAGTCAAGAACTACGCATAATTCTGATTTTGTGAAGAAGAGATCNNTCAGNCAGNNT
NNGATCGTCCCGCATAATGGACATGCNCCTGTCAANCNCCAGAANNCGTGGAGCGAACCG
TTTCNAGAGTTNTGNANNGGAAGAACGGCATACTGAANCCTCTNCAAAATATCNCNTATA
ATNTGTANTAANGTCANAGNACTGNGGCTNCCTTCTTTNGGTCNATGGTACCCANACCAT
TTAATTCCTGANGGGCNATCCTTNTNATCGAATGNAANGGCNNCCTTGAGTNATTATNAT
NNGACNGNTGNNTNATNAATACATGCCACTGGACCCGCCCCTTTGGACCTGCTTNCTTTT
NGATGNTNAATGTTCCNNCTTAATNTATGCCTGCCNCAATGGTTTNNCGCCTNGTTANCC
NTCCAATGGANNCNANGGNTTTTNGGAGGGGNANNAAAAGNGNNCNGNNNNTTTTTNNAN
TTACTCCNNAATNNCCCNTGCCNGGNNATCCCNTTTCNNGCCCNCCTNNNNTNTCCCCNT
NGGGNNCCNCCTNGGGCTTCNNNGNNGAACGGCCCCNCNTTNATTTTTTNNNTTNNNNCA
NTNGTTNNNGGGTTTNNANNcctcccntttngnctnttttttttnnggnnnnancctnnt
nccnntntnnccncntnnccccccnncnnnnnnncnttnnnnnngnnnnnnttcnccncc
nnnnnnnntcnnnnnnnntnntttttttnccccntnntnttcncnnnttnnnncncaaaa
cact

Library Name / Clone Name np / np64493_0309
Strand Plus
Insertion Point 8325770
Chromosome Band 3R
Flanking Sequence
ntttttggntncgcanttcntgcaagtcatgacgttagtggatgtctcttgccgacgggc
accaccttatgttatttcatcatgGTACAGNACATCTACTTCCCCCCGCTCCTACCCGCG
ACCAGNACTACGTTCGGCAGAAACTCTAACGGTTGTCTGCCGCGCATCAGAAAAATAAAA
AAAAACGTCTGCATGGCGCGTGCCAAGCAGAAACACGAAATTTCGTTTCATTTAAATGAT
CCGNGGCCTNNNGCTTNGGCNACTNGTGGATCTGGATCCTTTAGCTNGAGCTTTGNGTGC
NNNNNCTTNNTGTAAATANAANNATNTNAATNNNNNNATNNGNATACNTTTATGNNNTTT
NAAANCCNNNNANTNGNNTNCNNTNNNNANGNNNANNNNNNNNNNNNNNNTNGNNNNANN
NTNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnccn


CLOSE