Detailed Information [114022]

Strain Information
DGRC Number 114022
Genotype with FlyBase Link y[1] w[*] / C(1;Y)*, y[+]; P{w[+mW.hs]=GawB}NP6657 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y1 w* / C(1;Y)*, y+; P{w+mW.hs=GawB}NP6657 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 66D10
Map Viewer
Related Genes CG6486 h
Original Number 6657
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP6657

NP line. Received from the National Institute of Genetics.

Original Comments comment1:A, comment2:66D
Balancer TM6UW23-1
Cluster id 1830
General Information NP_lines
Embryonic Expression clean and strong pair rule
Larval GFP all muscle
Larval X-gal distal domain (from tarsus to tibia) of the leg/antenna disc, dorsal posterior broad stripe along A/P boundary in wing/haltere discs, strong epi
Adult GFP epi and muscle of thorax and abd. ant wing mergin.
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np01395_0711
Strand Minus
Insertion Point 8634368
Chromosome Band 3L
Flanking Sequence
antacttggggaaaaaancccttnttngnatacttangnnaaccttcggctatcgacggg
accaccttatgttatttcatcatgGTATACATTATGCGCTACCTGCTCGCTTCAGTGTGT
GCGTGTGTGTGTGCGTGCTCGCGCTTGTGAGCGGTACCTAAAGTACACACCGCGTTACTC
ATACGCCCCCGTGGCTCGCGGGAATGGGCATTTNTTTTTTTTTGGAAATCACACTGCGAA
ACCCCCATTGGTgatcgaagaatacataagagagaaccgtcgccaaagaacccattattg
ttggggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatca
aatccatgaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatga
gctgccgagtcaatcgatacagtcaactgnctttgacctttgttactactctcttccgat
gatgatgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgag
catnttnnnntnnnggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)

d2 (->Large)

d3 (->Large)

d4 (->Large)
Embryo

e1 (->Large)

e2 (->Large)

e3 (->Large)

e4 (->Large)


CLOSE